Dysregulation in EGF/ERBB signaling pathway may explain abnormalities of neural precursor migration in bipolar disorder

Salil K. Sukumaran, Pradip Paul, Vishwesha Guttal, Bharath Holla, Alekhya Vemula, Harsimar Bhatt, Piyush Bisht, Kezia Mathew, Ravi K Nadella, Anu Mary Varghese, K Vijayalakshmi, Meera Purushottam, Sanjeev Jain, ADBS Consortium, Reeteka Sud, Biju Viswanath
doi: https://doi.org/10.1101/2021.04.22.21254208

ABSTRACT

Cellular migration is a ubiquitous feature that brings brain cells into appropriate spatial relationships over time; and is believed to contribute to the pathology of bipolar disorder (BD). There are also structural differences in BD-brain, demonstrated by multiple imaging studies. We studied the movement patterns of induced pluripotent stem cell (IPSC) derived neural precursor cell (NPC) derived from individuals with BD, in an effort to recapitulate and study anomalies in migration. These individual patients had a severe clinical phenotype, including anomalies in structural brain imaging. We conducted time-lapse analysis and identified abnormal directionality of cellular migration in NPCs derived from these patients. We further studied the whole exome, and NPC transcriptomes of these patients, to investigate the underlying mechanisms of aberrant migration. Whole exome sequencing revealed several rare and deleterious variants in migration-related genes. Transcriptomic analysis showed downregulation of genes that were part of the EGF/ERBB signaling pathway. We suggest that collective, systemic dysregulation may produce the aberrant cellular phenotype; which could contribute to the functional and structural changes in the brain, reported in bipolar disorder.

1. Introduction

Bipolar disorder (BD) is a severe disabling psychiatric illness with a genetic basis, and neurodevelopmental origins [Gandal et al., 2018]. Many of the identified genes in BD risk, are implicated in neurodevelopmental processes and variations in brain morphology [Ganesh et al., 2019; Ithal et al., 2021]. Multiple studies have documented abnormalities in brain structure in BD [Magioncalda and Martino, 2021] including smaller brain size, reduced cortical gray and white matter [Ching et al., 2020], cortical thinning [Hibar et al., 2018], and decreased interneurons in the cerebral cortex and hippocampus [Harrison et al., 2020]. Cortical plasticity would also mediate the structural alterations and cognitive changes, seen over the life span in those with BD [Van Rheenen et al 2020]. Such brain changes in BD have also been shown to be predicted by genetic risk [Abe et al., 2021]. However, fundamental mechanisms linking genetic risk to brain changes are not well understood.

One method to interrogate cellular alterations related to brain abnormalities is to study induced pluripotent stem cells (IPSCs) derived from patients, in whom changes have been detected on brain imaging. Although a direct link is difficult, this could help to identify potential contributory mechanisms. Previous IPSC-based studies have uncovered that BD pathogenesis is associated with differences in (a) expression of ion channels and membrane-bound receptors in neurons [Chen et al., 2014]; (b) neurogenesis and expression of genes of the WNT signaling [Madison et al., 2015]; and (c) mitochondrial abnormalities in patient-derived neurons [Mertens et al., 2015], as well as neural precursors [Paul et al., 2020; Osete et al., 2021].

There have been some attempts to integrate human brain imaging with IPSC experiments in psychiatry [Johnstone et al., 2019; Vasistha et al., 2019]. Both studies evaluated persons from families with multiple members with schizophrenia. One study correlated reduction of cortical brain volumes with abnormal proliferation of neural precursor cells (NPCs) [Johnstone et al., 2019], whereas the other study found oligodendrocyte proliferation and morphology deficits in individuals who had white matter alterations in brain using diffusion tensor imaging [Vasistha et al., 2019].

Here, we used IPSC-derived NPCs from two related patients who had abnormalities in brain imaging, and hypothesized that they would have abnormalities in IPSC derived NPCs. Based on the above two papers in schizophrenia, one key assay would be that of proliferation. In contrast, however, we have detected an enhanced proliferation of NPCs derived from both these patients [Paul et al., 2020]. We thus focused on NPC migration, as there is evidence to suggest aberrations in migration as one of the contributing factors in BD pathogenesis [Muñoz-Estrada et al., 2015]. We find that both patient NPCs displayed greater randomness in migration patterns similar to Brownian motion, unlike the directed movements in the control NPC. Further, whole exome sequencing revealed multiple rare and deleterious variants in migration related genes, and transcriptome analysis revealed expression changes in several genes known to regulate cellular migration, implicating the EGF/ERBB signaling pathway.

2. Experimental Procedures

The NPCs from two BD-patients from a multiple affected family, and one healthy control line were used for experiments (pedigree and clinical details in Paul et al., 2020). Details of clinical assessments [Viswanath et al., 2018], magnetic resonance imaging (MRI) [Bhalerao et al., 2021; Holla et al., 2018; Parekh and Naik, 2021], generation of NPCs and their cellular characterization have been described earlier [Mukherjee et al., 2019; Paul et al., 2020]. The study was approved by the ethics committee of the National Institute of Mental Health and Neurosciences, Bengaluru, India, and conforms to the ethical norms and standards in the Declaration of Helsinki.

2.1 MRI analysis

Global brain volumes (grey and white matter) were calculated using the FreeSurfer software suite (v6.0). Individualized centiles for each tissue class were calculated using out of sample log likelihood estimation against the bootstrapped model parameters obtained from the expected age-related trends from a large aggregated database of reference brain volumes [Bethlehem R.A.I, 2021]. This database included normative brain volumes of Indian subjects for ages 6-60 years [Bethlehem R.A.I, 2021; Holla et al., 2020].

2.2 Assessment of migratory capacity of neural precursor cells

Cells were seeded in Ibidi Culture-Insert 2-well in μ-dish (Cat. no. 81176, ibidi GmbH, Germany), at a density of 15000 - 20000 cells. Passage numbers for NPCs ranged between P10-P19. Movement of cells across the 500-μm gap in the Ibidi dish was recorded in time-lapse images — every 15 min, for 15 hours with an Olympus microscope equipped with a camera (Hamamatsu) using a 10X dry objective. The experiments for each cell line were done in three biological replicates. Migration of NPCs were tracked for 12 hours, in a 37°C humidified chamber with 5% CO2, and quantified using ImageJ (Version IJ1.46r) with the plugin ‘Manual Tracking’.

2.3 Quantitative movement analysis of cellular migration

The paths of migrating NPCs were tracked with the help of X and Y coordinates from the images taken. From the trajectories of each cell, we estimated the (i) average speed (over 15 minutes intervals) and (ii) displacement between the initial and final locations (after 15 hours). The box-plot (Fig. 1E) shows displacement of 100 cells (cumulative from three experiments) for each cell line.

Figure 1:
Figure 1: Abnormal migration phenotype in patient-derived neural precursors

A. Freesurfer based segmentation of T1w image into grey matter (Dark grey), white matter (light grey) and ventricles (light blue). The top row shows axial slices for B1 and bottom row shows axial slices for B2. A, Anterior; P, Posterior; R, Right; and L, Left. cGMV, Total cortical gray matter volume; WMV, Total cerebral white matter volume; sGMV, Subcortical gray matter volume.

B. Migration of neural precursor cells from C1, B1 and B2 at different time points. Only C1 closed the gap after 12 hours of migration.

C. Direction of migration: C1 migrated in a directional pattern; B1 and B2 cells, on the other hand, migrated in random, non-directed manner. Both BD lines showed back and forth movement, directional and circular patterns of migration.

D. Sample migratory paths of C1, B1 and B2 lines over 15 hours.

E. Box plots of displacement of the migrating cells after 15 hours (n = 100 cells per line).

F. Mean squared displacement (MSD) as a function of time (in minutes), averaged over 100 cells per line.

G. Comparing the speed of migration for C1, B1 and B2 cells (Mean ± SD, over 15 hours): B1 cells migrated at a speed 1.21± 0.15 µm/min***, B2 cells at 0.50 ± 0.17 µm/min***; whereas C1 cells moved at 0.55 ± 0.17 µm/min. Mean speed of C1 and B2 cell lines are statistically different from those of B1(P value: ***< 0.001).

From (ii), we also computed mean-squared displacement (MSD) as a function of time separation between any two points along a cell’s trajectory. The MSD exponent α, which determines the functional relationship between MSD and the time lag (tau), given by MSD(τ)∼τ α, was also calculated. When α = 1, the cells are said to exhibit Brownian motion (or diffusive motion), whereas deviation from this value — termed anomalous diffusion values of α > 1 represent super-diffusive motion (or if α <1, sub-diffusive motion). A value of α = 2, implies that cells are migrating via a highly persistent or ballistic motion [Dietrich et al., 2008; Gal et al., 2013].

2.4 Transcriptome analysis

RNA-Seq of the NPCs was performed on the Illumina® Hi-Seq platform. Genes which showed >1-fold difference with FDR adjusted P-value < 0.05 were considered differentially expressed, as detailed elsewhere [Paul et al., 2020]. ConsensusPathDB analysis (Release 34) [Kamburov et al., 2011, 2009] was performed for functional enrichment of pathways related to cellular migration (keywords “migration” and “motility”). The gene lists from all these pathways was extracted. In addition, the data from published references on genes related to migration were included [Snel et al., 2000; Suyama et al., 2003; Simpson et al., 2008; Wu et al., 2008; Bavamian et al., 2015; Madison et al., 2015; Buchsbaum and Cappello, 2019; Szklarczyk et al., 2019] to create a collated list of migration related genes (N=290).

2.5 Identification of exonic variants in migration-related genes

Variants were identified from the whole exome sequencing data [Suhas et al., 2019], which were further annotated using ANNOVAR [Yang et al., 2015]. Variants were prioritised by a two-step filtering process: (1) predicted to be deleterious by at least six of the 12 in silico tools (SIFT, Polyphen2_HDIV, Polyphen2_HVAR, LRT, MutationTaster, MutationAssessor, FATHMM, PROVEAN, MetaSVM, MetaLR, M-CAP, fathmm-MKL); (2) had a population frequency less than 1% in the south Asian (SAS) samples of the Exome Aggregation Consortium (ExAC) database.

3. Results

3.1 Abnormalities in brain MRIs of BD patients

In the scans of B1, we found that all tissue-specific brain volumes were below the 5th centile, demonstrating a clear deviation from age-related trends. In B2, lower grey matter (cortical at 10th centile and subcortical at ∼ 1/3rd centile) was detected, but the white matter volumes (∼50th centile) were not deviant from age-related trends (Figure 1A).

3.2 Aberrant cellular migration in patient-derived neural precursors

Visual inspection revealed that cells from C1 line migrate in a directed manner; while B1 and B2 lines moved in a random (Brownian) manner throughout the duration of the experiment (Fig. 1D). The patient-derived lines also showed mixed patterns in the direction of migration: cells migrated in circular tracks as well as back-and-forth, in addition to some that migrated in a directed pattern (Fig. 1D; Supplementary Fig. S1). Quantitative analysis confirmed these visually observed differences between the migration trajectory of the control (C1) and both patient-derived lines (Fig. 1F). The value of MSD exponent α was 1.54 (with a 95% CI of 1.52 to 1.57) for control line (C1), which indicates while these cells did show randomness, they also exhibited a degree of directed motion. In contrast, the MSD exponent α values were 1.22 (95% CI: 1.21 to 1.24) and 1.27 (95% CI: 1.26 to 1.28) for the B1 and B2 lines respectively, suggesting a trajectory that was closer to a Brownian movement pattern (Fig. 1F). There were no differences in overall displacement (Fig. 1E), although B1 additionally showed greater speed (Fig. 1G).

3.3 Transcriptome analysis revealed differential expression of RNA transcripts related to cell migration

Transcriptomic analysis was carried out to further explore the basis of the differential cellular phenotype. Our analysis for the migration related genes (N=290) revealed that there were 61 transcripts in B1 and 58 in B2 that were differentially expressed, in comparison with C1. Of these, 29 transcripts were dysregulated across both patient-derived lines (Fig. 2B, C). Functional interaction of the above 29 using STRING highlighted a densely interconnected network of proteins, centered on ERBB proteins (Fig. 2D, Supplementary. Fig. S2). Downregulation of LAMA1 and NRG2 was confirmed using real-time q-PCR (Supplementary. Fig. S3).

Figure 2:
Figure 2: RNA-seq analysis shows dysregulated EGF/ERBB signaling pathway in patient-derived NPCs

A. Transcriptome analysis pipeline

B. Transcripts common and unique to B1 and B2 patient-derived lines

C. Comparison of fold change for common transcripts among the two patient-derived neural precursor lines.

D. Protein interaction network, centered on ERBB4, that is downregulated in patient-derived NPCs. The interactions were plotted using STRING online database (https://string-db.org/).

The entire interaction network is shown in Supplementary Figure S2.

3.4 Whole exome sequencing analysis revealed rare, deleterious variants in migration related genes

To explore the possibility of genetic variations contributing to observed phenotypic differences in B1 and B2 lines, we also examined the whole exome data to identify variants in genes related to migration (N=290). The combined criteria of deleteriousness (as predicted by 6 bioinformatic tools) and rarity (MAF < 1% in Exome Aggregation Consortium for South Asian population) identified variants in LAMA1, LAMA5, DNAH5, RUNX2, MYH14 and NRG2 in our lines B1 and B2. Of these, DNAH5 and LAMA1 were seen in both the lines. The MYH14 and NRG2 variants were exclusive to the B1 line whereas LAMA5 and RUNX2 variants were exclusive to the B2 line (Supplementary Table 1).

4. Discussion

The BD patients in this study were chosen for their severe clinical phenotype, including abnormalities noted on brain MRI (Fig. 1A). Possible reasons for decreased brain volume noted on their MRIs could be reduced proliferation of NPCs, neuronal apoptosis, or abnormalities in migration of NPCs. Interestingly, our previous study showed that proliferation of NPCs (from the same patients) is actually increased, when compared to controls [Paul et al., 2020]. Experiments reported in present study were undertaken to investigate whether cellular migration may contribute to the brain abnormalities observed in these patients.

The NPCs from a healthy control migrated towards other cells (directed/ ballistic movement), (Fig. 1C, D, F). However, patient-derived NPCs continued migrating in a random trajectory that was closer to a Brownian movement pattern throughout the observation period. The transcriptome analysis (Figure 2A) showed numerous migration related genes dysregulated in the patient-derived NPCs (Fig. 2B, C). Exome sequencing revealed multiple rare deleterious migration related genetic variants (Supplementary Table 1). We thus identified changes in migration, and possible factors that contributed to this pattern.

The results of the STRING analysis (Fig. 2D, Supplementary. Fig. S2) pointed to the centrality of the ERBB proteins. The ERBB proteins form the hub of a network that includes direct interactions with several proteins which are involved in regulating different aspects of cellular migration, and include tyrosine protein kinases that function as cell surface receptors for neuregulins, EGF and other similar ligands. They are central to the development of multiple organs, including the brain, where they regulate many functions including cell proliferation, differentiation, migration and apoptosis. Ligand binding triggers receptor dimerization and autophosphorylation at specific tyrosine residues, which then serve as binding sites for scaffold proteins and effectors. These proteins can form homo- or hetero-dimers, with other ERBB family members, thereby creating multiple combinations of intracellular phosphotyrosines that trigger ligand- and context-specific cellular responses.

Proteins that are part of the EGF/ERBB network (Supplementary. Fig. S2) fulfil different roles in migration of neural precursors. EGFR, PLCG2 and PRKCA, for instance, regulate migration via calcium signaling [Büttner et al., 2018]. Inhibition of ERBB receptors lead to suppression of cancer cell migration [Momeny et al., 2017]; and inhibition of NRG1/ERBB2 signaling reduced the migration of human glioma cells [Ritch et al., 2003].

Multiple groups have shown the involvement of EGFR signaling in migration of numerous cell types. Though earlier reports have been in the context of cancer cell migration, our results show that this signaling may be crucial for migration of neural stem/precursor cells to reach their appropriate location in the brain. In cancer cells, the dynamics of EGFR signaling to migration is rather linear — these proteins are upregulated in migrating cancerous cells, and their experimental downregulation hampers the migration process. In the case of NPCs, as we found out, the relationship is less so. In patient-derived NPCs, the EGF signaling pathway is downregulated. The cellular phenotype difference we observed involved relatively uncoordinated movements during migration.

Rahimi-Balaei et al., (2018) described the role of neuronal migration and directionality in the development of the central nervous system. Barber et al., (2015) demonstrated that migration speed and directionality of early-born cortical neurons controls the size of higher order cortical areas. The authors suggested that changing the speed and direction of migrating cells, alters the regional cellular make-up, and therefore wiring of cortical areas. Understanding how phenotypic changes such as speed or randomness at the individual level can alter collective behavior is a question of fundamental importance not only in the context of brain disease, but also in the broader context of collective behavior in biological systems [Jhawar et al., 2020; Davidson et al., 2021]. Stochasticity is inherent in all biological systems, and its characterization may help us decipher local scale interactions among individual organisms or cells [Jhawar et al., 2020; Jhawar and Guttal 2020; Bruckner et al., 2020]. An understanding of how single cells move, their inherent stochasticity and interaction can be crucial for understanding phenomena across scales, from tissue organization to wound healing and repair, and organization within brain [Davidson et al., 2021; Otsuki and Brand, 2020; Silva et al., 2019, Zinner et al., 2020].

Overall, our previous work [Paul et al., 2020] and current analysis, indicate that there are multiple cellular abnormalities in these BD NPCs. These cells proliferate faster, and have aberrant migration patterns. Whether these could, in part, be responsible for the deviations in grey and white matter, as detected on the MRI imaging, in these subjects, is of course a matter of conjecture. Correlating genomic variations, with phenotypes at various levels (cell, tissue, organ and system) is not feasible at present, but further validation may help us understand these links, and thus the mechanisms of disease. The current work could extend to an investigation of 3D organoids (mini-brains), to examine aspects of organization and functionality in more detail. We are attempting this using IPSCs derived from several individuals, from multiple affected families with BD, to better understand the effects of altered NPC directionality on the overall structure of the developing and dynamic, mature brain. The integration of deep clinical phenotyping with IPSC models in such sample sets will be crucial to understand the pathobiology of BD, and the mechanisms of recovery and resilience.

Data Availability

Available upon request

Conflict of Interest

The authors declare that they have no conflict of interest

Role of funding source

This work was supported by a grant from the Department of Biotechnology (COE), India funded grants- “Accelerating program for discovery in brain disorders using stem cells” (BT/PR17316/MED/31/326/2015) (ADBS); the Department of Science and Technology, “Targeted generation and interrogation of cellular models and networks in neuro-psychiatric disorders using candidate genes” (BT/01/CEIB/11/VI/11/2012); “Imaging-genomics approach to identify molecular markers of Lithium response in Bipolar disorder” through the DST-INSPIRE Faculty Fellowship awarded to Dr. Biju Viswanath (Project number 00671, Code: IFA-12-LSBM-44) and SCIENCE & ENGINEERING RESEARCH BOARD (SERB) project “Dissecting the biology of lithium response in human induced pluripotent stem cell derived neurons from patients with bipolar affective disorder”. The results of this work have been partially presented as a poster in the conference- at XXVIIIth World Congress of Psychiatry Genetics, 2020, and also received the Hugh Gurling award 2020.

Contributors

S.K.S - NPC experiments, wrote the first draft, prepared figures, read and approved the final manuscript. S.K.S and P.P - Performed q-PCR. V.G. - Performed NPC quantitative movement data analysis. B.H. - MRI data analysis. A.V. - Exome data analysis. H.B. - Helped with the migration experiments. P.B. - Standardised the primers. R.K.N. - Performed clinical assessments. A.M.V and V.K. - Helped with the migration experiments. M.P. - Supervision of cellular experiments, read and approved the final manuscript. S.J. - Supervision of experiments, read and approved the final manuscript. R.S. - Supervision of cellular experiments, editing drafts, read and approved the final manuscript. B.V. -, supervised clinical assessments and cellular experiments, read and approved the final manuscript. The overall study design was developed as part of the ADBS. All authors contributed to and have approved the final manuscript.

Supplementary Methods

Total RNA was extracted using the Qiagen RNeasy Mini Kit (Cat. No: 74104). cDNA synthesis was performed with 1.5ug of RNA using High-Capacity cDNA Reverse Transcription Kit (Thermofisher Cat. No: 4368814). Sample cDNA and ‘no template control’ (NTC) were run in triplicates with the Quant Studio 6 Flex Real-time qPCR system (Thermofisher). The qPCR reaction was carried out with SYBR Green Master Mix (Takyon(tm) Low ROX) and 0.5 μM of each primer. Relative gene expression was estimated as previously described (Paul et al. 2020), and normalized to housekeeping gene UBC.

The primer sequences are:

LAMA1 Forward : 5’ GAGCATGGAGAGATTCATACATC 3’

LAMA1 Reverse : 5’ GGTCATGAGATCTGCATTGA 3’

NRG2 Forward : 5’ GCAACGGCAGAAAGAACTCA 3’

NRG2 Reverse : 5’ CTTCCCCAGGATGTTCTCGG 3’

UBC Forward : 5’ CTGGAAGATGGTCGTACCCTG 3’

UBC Reverse : 5’ GGTCTTGCCAGTGAGTGTCT 3’

Supplementary Figures

S1. Representative recordings of cellular migration in B1, B2 and C1 lines. Migration tracks of individual cells were recorded by marking the position of nucleus in individual frames. Colored lines indicate positions of individual cells during the duration of migration assay. While the migration pattern in C1 is largely linear (S1-A), showing individual cells from either side of 500µm gap; in B1 and B2 lines (S1-B and S1-C), we encountered mixed patterns of cellular migration: apart from linear trajectory, these NPCs also demonstrated back-and-forth as well as circular motions. Images for migration of control and B1 cells were captured with 4x objective and B2 cell migration captured with 10x objective.

S2. Functional interactions among proteins shortlisted from Fig. 2C, explored using STRING online database. Only those proteins were included where direction of change of expression was similar in the two patient-derived lines.

S3. Real-time qPCR analysis of LAMA1 and NRG2 gene expression in B1 and B2 lines. Data are represented as Mean ± SD from three samples per individual group of two independent experiments.

Acknowledgements

The authors would like to thank Dr. Jitesh Jhawar, postdoctoral researcher, Department of Collective Behavior, Max Planck Institute of Animal Behavior, University of Konstanz, for his valuable suggestions on ImageJ analysis; Dr. Ravi Muddashetty and Dr. Dasaradhi Palakodety for providing computational facilities for transcriptome analysis; Ms.Chitra B. and Mr. Mallappa M. for technical support. We are grateful to the participants and their families for their cooperation, as well as to clinicians and staff at NIMHANS for their assistance.

References

  1. ↵
    Barber M, Arai Y, Morishita Y, Vigier L, Causeret F, Borello U, Ledonne F, Coppola E, Contremoulins V, Pfrieger FW, Tissir F, Govindan S, Jabaudon D, Proux-Gillardeaux V, Galli T, Pierani A. (2015). Migration speed of Cajal-Retzius cells modulated by vesicular trafficking controls the size of higher-order cortical areas. Curr. Biol. 25, 2466–2478. doi: 10.1016/j.cub.2015.08.028
    OpenUrlCrossRefPubMed
  2. ↵
    Bavamian S, Mellios N, Lalonde J, Fass DM, Wang J, Sheridan SD, Madison JM, Zhou F, Rueckert EH, Barker D, Perlis RH, Sur M, Haggarty SJ. (2015). Dysregulation of miR-34a links neuronal development to genetic risk factors for bipolar disorder. Mol. Psychiatry 20, 573–584. doi: 10.1038/mp.2014.176
    OpenUrlCrossRef
  3. ↵
    Bethlehem R.A.I. (2021). Brain charts for the human lifespan. bioRxiv: 1–26.
  4. ↵
    Bhalerao GV, Parekh P, Saini J, Venkatasubramanian G, John JP, Viswanath B, Rao NP, Narayanaswamy JC, Sivakumar PT, Kandasamy A, Kesavan M, Mehta UM, Mukherjee O, Purushottam M, Kannan R, Mehta B, Kandavel T, Binukumar B, Jayarajan D, Shyamsundar A, Moirangthem S, Vijay Kumar KG, Mahadevan J, Holla B, Thirthalli J, Chandra PS, Gangadhar BN, Murthy P, Panicker MM, Bhalla US, Chattarji S, Benegal V, Varghese M, Reddy JYC, Raghu P, Rao M, Jain S. (2021). Systematic evaluation of the impact of defacing on quality and volumetric assessments on T1-weighted MR-images. J. Neuroradiol. 9861. doi: 10.1016/j.neurad.2021.03.001
    OpenUrlCrossRef
  5. Brückner, D. B., Fink, A., Schreiber, C., Röttgermann, P. J., Rädler, J. O., Broedersz, C. P. (2019). Stochastic nonlinear dynamics of confined cell migration in two-state systems. Nature Physics, 15(6), 595–601. doi: 10.1038/s41567-019-0493-9
    OpenUrlCrossRef
  6. ↵
    Buchsbaum IY, Cappello S. (2019). Neuronal migration in the CNS during development and disease: Insights from in vivo and in vitro models. Dev. 146. doi: 10.1242/dev.163766
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Büttner P, Ueberham L, Shoemaker MB, Roden DM, Dinov B, Hindricks G, Bollmann A, Husser D. (2018). Identification of central regulators of calcium signaling and ECM-receptor interaction genetically associated with the progression and recurrence of atrial fibrillation. Front. Genet. 9, 1–6. doi: 10.3389/fgene.2018.00162
    OpenUrlCrossRef
  8. Cheffer A, Flitsch LJ, Krutenko T, Röderer P, Sokhranyaeva L, Iefremova V, Hajo M, Peitz M, Schwarz MK, Brüstle O. (2020). Human stem cell-based models for studying autism spectrum disorder-related neuronal dysfunction. Mol. Autism 11, 1–23. doi: 10.1186/s13229-020-00383-w
    OpenUrlCrossRef
  9. ↵
    Chen HM, DeLong CJ, Bame M, Rajapakse I, Herron TJ, McInnis MG, O’Shea KS. (2014). Transcripts involved in calcium signaling and telencephalic neuronal fate are altered in induced pluripotent stem cells from bipolar disorder patients. Transl. Psychiatry 4, e375. doi: 10.1038/tp.2014.12.
    OpenUrlCrossRef
  10. ↵
    Ching CRK, Hibar DP, Gurholt TP, Nunes A, Thomopoulos SI, Abé C, Agartz I, Brouwer RM, Cannon DM, de Zwarte SMC, Eyler LT, Favre P, Hajek T, Haukvik UK, Houenou J, Landén M, Lett TA, McDonald C, Nabulsi L, Patel Y, Pauling ME, Paus T, Radua J, Soeiro-de-Souza MG, Tronchin G, van Haren NEM, Vieta E, Walter H, Zeng LL, Alda M, Almeida J, Alnæs D, Alonso-Lana S, Altimus C, Bauer M, Baune BT, Bearden CE, Bellani M, Benedetti F, Berk M, Bilderbeck AC, Blumberg HP, Bøen E, Bollettini I, del Mar Bonnin C, Brambilla P, Canales-Rodríguez EJ, Caseras X, Dandash O, Dannlowski U, Delvecchio G, Díaz-Zuluaga AM, Dima D, Duchesnay É, Elvsåshagen T, Fears SC, Frangou S, Fullerton JM, Glahn DC, Goikolea JM, Green MJ, Grotegerd D, Gruber O, Haarman BCM, Henry C, Howells FM, Ives-Deliperi V, Jansen A, Kircher TTJ, Knöchel C, Kramer B, Lafer B, López-Jaramillo C, Machado-Vieira R, MacIntosh BJ, Melloni EMT, Mitchell PB, Nenadic I, Nery F, Nugent AC, Oertel V, Ophoff RA, Ota M, Overs BJ, Pham DL, Phillips ML, Pineda-Zapata JA, Poletti S, Polosan M, Pomarol-Clotet E, Pouchon A, Quidé Y, Rive MM, Roberts G, Ruhe HG, Salvador R, Sarró S, Satterthwaite TD, et al. (2020). What we learn about bipolar disorder from large-scale neuroimaging: Findings and future directions from the ENIGMA bipolar disorder working group. Hum. Brain Mapp. 1–27. doi: 10.1002/hbm.25098
    OpenUrlCrossRef
  11. ↵
    Davidson, J. D., Vishwakarma, M., Smith, M. L. (2021). Hierarchical approach for comparing collective behavior across scales: Cellular systems to honey bee colonies. Frontiers in Ecology and Evolution, 9. doi: 10.3389/fevo.2021.581222
    OpenUrlCrossRef
  12. ↵
    Ganesh S, Ahmed P. H, Nadella RK, More RP, Seshadri M, Viswanath B, Rao M, Jain S, Mukherjee O. (2019). Exome sequencing in families with severe mental illness identifies novel and rare variants in genes implicated in mendelian neuropsychiatric syndromes. Psychiatry Clin. Neurosci. 73, 11–19. doi: 10.1111/pcn.12788
    OpenUrlCrossRef
  13. Grove M, Demyanenko G, Echarri A, Zipfel PA, Quiroz ME, Rodriguiz RM, Playford M, Martensen SA, Robinson MR, Wetsel WC, Maness PF, Pendergast AM. (2004). Abi2-Deficient mice exhibit defective cell migration, aberrant dendritic spine morphogenesis, and deficits in learning and memory. Mol. Cell. Biol. 24, 10905–10922. doi:10.1128/MCB.24.24.10905-10922.2004
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Harrison PJ, Colbourne L, Harrison CH. (2020). The neuropathology of bipolar disorder: systematic review and meta-analysis. Mol. Psychiatry 25, 1787–1808. doi: 0.1038/s41380-018-0213-3
    OpenUrlCrossRef
  15. ↵
    Hibar DP, Westlye LT, Doan NT, Jahanshad N, Cheung JW, Ching CRK, Versace A, Bilderbeck AC, Uhlmann A, Mwangi B, Krämer B, Overs B, Hartberg CB, Abe C, Dima D, Grotegerd D, Sprooten E, Ben E, Jimenez E, Howells FM, Delvecchio G, Temmingh H, Starke J, Almeida JRC, Goikolea JM, Houenou J, Beard LM, Rauer L, Abramovic L, Bonnin M, Ponteduro MF, Keil M, Rive MM, Yao N, Yalin N, Najt P, Rosa PG, Redlich R, Trost S, Hagenaars S, Fears SC, Alonso-Lana S, Van Erp TGM, Nickson T, Chaim-Avancini TM, Meier TB, Elvsashagen T, Haukvik UK, Lee WH, Schene AH, Lloyd AJ, Young AH, Nugent A, Dale AM, Pfennig A, McIntosh AM, Lafer B, Baune BT, Ekman CJ, Zarate CA, Bearden CE, Henry C, Simhandl C, McDonald C, Bourne C, Stein DJ, Wolf DH, Cannon DM, Glahn DC, Veltman DJ, Pomarol-Clotet E, Vieta E, Canales-Rodriguez EJ, Nery FG, Duran FLS, Busatto GF, Roberts G, Pearlson GD, Goodwin GM, Kugel H, Whalley HC, Ruhe HG, Soares JC, Fullerton JM, Rybakowski JK, Savitz J, Chaim KT, Fatjó-Vilas M, Soeiro-De-Souza MG, Boks MP, Zanetti M V., Otaduy MCG, Schaufelberger MS, Alda M, Ingvar M, Phillips ML, Kempton MJ, Bauer M, et al. (2018). Cortical abnormalities in bipolar disorder: An MRI analysis of 6503 individuals from the ENIGMA bipolar disorder working group. Mol. Psychiatry 23, 932–942. doi: 10.1038/mp.2017.73
    OpenUrlCrossRefPubMed
  16. ↵
    Holla B, Karthik S, Biswal J, Viswanath B. (2018). Brain functional magnetic resonance imaging cue-reactivity can predict baclofen response in alcohol use disorders cognition view project yoga and schizophrenia-a comprehensive assessment of neuroplasticity view project. Artic. Clin. Psychopharmacol. Neurosci. 16, 290–300. doi: 10.9758/cpn.2018.16.3.290
    OpenUrlCrossRef
  17. ↵
    Holla B, Taylor PA, Glen DR, Lee JA, Vaidya N, Mehta UM, Venkatasubramanian G, Pal PK, Saini J, Rao NP, Ahuja CK, Kuriyan R, Krishna M, Basu D, Kalyanram K, Chakrabarti A, Orfanos DP, Barker GJ, Cox RW, Schumann G, Bharath RD, Benegal V. (2020). A series of five population-specific Indian brain templates and atlases spanning ages 6–60 years. Hum. Brain Mapp. 41, 5164–5175. doi: 10.1002/hbm.25182
    OpenUrlCrossRef
  18. ↵
    Jhawar J, Guttal V. Noise-induced effects in collective dynamics and inferring local interactions from data. (2020). Philos Trans R Soc Lond B Biol Sci. 14, 1807. doi: 10.1098/rstb.2019.0381
    OpenUrlCrossRef
  19. ↵
    Jhawar, J., Morris, R. G., Amith-Kumar, U. R., Raj, M. D., Rogers, T., Rajendran, H., Guttal, V. (2020). Noise-induced schooling of fish. Nature Physics, 16(4), 488–493. doi: 10.1038/s41567-020-0787-y
    OpenUrlCrossRef
  20. ↵
    Johnstone M, Vasistha NA, Barbu MC, Dando O, Burr K, Christopher E, Glen S, Robert C, Fetit R, Macleod KG, Livesey MR, Clair DS, Blackwood DHR, Millar K, Carragher NO, Hardingham GE, Wyllie DJA, Johnstone EC, Whalley HC, McIntosh AM, Lawrie SM, Chandran S. (2019). Reversal of proliferation deficits caused by chromosome 16p13.11 microduplication through targeting NFκB signaling: an integrated study of patient-derived neuronal precursor cells, cerebral organoids and in vivo brain imaging. Mol Psychiatry. 24, b294–311. doi: 10.1038/s41380-018-0292-1
    OpenUrlCrossRef
  21. Jones KA, Sumiya M, Woolfrey KM, Srivastava DP, Penzes P. (2019). Loss of EPAC2 alters dendritic spine morphology and inhibitory synapse density. Mol. Cell. Neurosci. 98, 19–31. doi: 10.1016/j.mcn.2019.05.001
    OpenUrlCrossRef
  22. ↵
    Kamburov A, Pentchev K, Galicka H, Wierling C, Lehrach H, Herwig R. (2011). ConsensusPathDB: Toward a more complete picture of cell biology. Nucleic Acids Res. 39, 712–717. doi: 10.1093/nar/gkq1156
    OpenUrlCrossRefPubMedWeb of Science
  23. ↵
    Kamburov A, Wierling C, Lehrach H, Herwig R. (2009). ConsensusPathDB - A database for integrating human functional interaction networks. Nucleic Acids Res. 37, 623–628. doi: 10.1093/nar/gkn698
    OpenUrlCrossRef
  24. Knöchel C, Reuter J, Reinke B, Stäblein M, Marbach K, Feddern R, Kuhlmann K, Alves G, Prvulovic D, Wenzler S, Linden DEJ, Oertel-Knöchel V. (2016). Cortical thinning in bipolar disorder and schizophrenia. Schizophr. Res. 172, 78–85. doi: 10.1016/j.schres.2016.02.007
    OpenUrlCrossRef
  25. ↵
    Madison JM, Zhou F, Nigam A, Hussain A, Barker DD, Nehme R, Van Der Ven K, Hsu J, Wolf P, Fleishman M, O’Dushlaine C, Rose S, Chambert K, Lau FH, Ahfeldt T, Rueckert EH, Sheridan SD, Fass DM, Nemesh J, Mullen TE, Daheron L, McCarroll S, Sklar P, Perlis RH, Haggarty SJ. (2015). Characterization of bipolar disorder patient-specific induced pluripotent stem cells from a family reveals neurodevelopmental and mRNA expression abnormalities. Mol. Psychiatry 20, 703–717. doi: 10.1038/mp.2015.7
    OpenUrlCrossRefPubMed
  26. ↵
    Magioncalda P, Martino M. (2021). A unified model of the pathophysiology of bipolar disorder. Mol. Psychiatry. doi: 10.1038/s41380-021-01091-4
    OpenUrlCrossRef
  27. Marchetto MCN, Carromeu C, Acab A, Yu D, Yeo GW, Mu Y, Chen G, Gage FH, Muotri AR. (2010). A model for neural development and treatment of rett syndrome using human induced pluripotent stem cells. Cell 143, 527–539. doi:10.1016/j.cell.2010.10.016
    OpenUrlCrossRefPubMedWeb of Science
  28. ↵
    Mertens J, Wang Q-W, Kim Y, Yu DX, Pham S, Yang B, Zheng Y, Diffenderfer KE, Zhang J, Soltani S, Eames T, Oedegaard KJ, Mccarthy MJ, Zandi PP, Alda M. (2015). Differential responses to lithium in hyperexcitable neurons from patients with bipolar disorder. Nature 527, 95–99. doi: 10.1038/nature15526
    OpenUrlCrossRefPubMed
  29. ↵
    Momeny M, Zarrinrad G, Moghaddaskho F, Poursheikhani A, Sankanian G, Zaghal A, Mirshahvaladi S, Esmaeili F, Eyvani H, Barghi F, Sabourinejad Z, Alishahi Z, Yousefi H, Ghasemi R, Dardaei L, Bashash D, Chahardouli B, Dehpour AR, Tavakkoly-Bazzaz J, Alimoghaddam K, Ghavamzadeh A, Ghaffari SH. (2017). Dacomitinib, a pan-inhibitor of ErbB receptors, suppresses growth and invasive capacity of chemoresistant ovarian carcinoma cells. Sci. Rep. 7, 1–12. doi: 10.1038/s41598-017-04147-0
    OpenUrlCrossRefPubMed
  30. ↵
    Mukherjee O, Acharya S, Rao M. (2019). Making NSC and neurons from patient-derived tissue samples. Methods Mol. Biol. 1919, 9–24. doi: 10.1007/978-1-4939-9007-8_2
    OpenUrlCrossRef
  31. ↵
    Muñoz-Estrada J, Benítez-King G, Berlanga C, Meza I. (2015). Altered subcellular distribution of the 75-kDa DISC1 isoform, cAMP accumulation, and decreased neuronal migration in schizophrenia and bipolar disorder: Implications for neurodevelopment. CNS Neurosci. Ther. 21, 446–453. doi: 10.1111/cns.12377
    OpenUrlCrossRef
  32. Noh H, Shao Z, Coyle JT, Chung S. (2017). Modeling schizophrenia pathogenesis using patient-derived induced pluripotent stem cells (iPSCs). Biochim. Biophys. Acta - Mol. Basis Dis. 1863, 2382–2387. doi: 10.1016/j.bbadis.2017.06.019
    OpenUrlCrossRef
  33. O’Shea KS, McInnis MG. (2015). Induced pluripotent stem cell (iPSC) models of bipolar disorder. Neuropsychopharmacology 40, 248–249. doi: 10.1038/npp.2014.221
    OpenUrlCrossRefPubMed
  34. O’Shea KS, McInnis MG. (2016). Neurodevelopmental origins of bipolar disorder: IPSC models. Mol. Cell. Neurosci. 73, 63–83. doi: 10.1016/j.mcn.2015.11.006
    OpenUrlCrossRefPubMed
  35. ↵
    Osete JR, Akkouh IA, de Assis DR, Szabo A, Frei E, Hughes T, Smeland OB, Steen NE, Andreassen OA, Djurovic S. (2021). Lithium increases mitochondrial respiration in iPSC-derived neural precursor cells from lithium responders. Mol. Psychiatry. doi: 10.1038/s41380-021-01164-4
    OpenUrlCrossRef
  36. ↵
    Otsuki L, Brand AH. (2020). Quiescent neural stem cells for brain repair and regeneration: lessons from model systems. Trends Neurosci. 43(4), 213–226. doi: 10.1016/j.tins.2020.02.002
    OpenUrlCrossRef
  37. ↵
    Parekh HP, Naik SAP. (2021). Role of magnetic resonance imaging in study of the patellofemoral joint morphological abnormalities predisposing to patellar instability. Int. J. Sci. Healthc. Res. 6, 208–215. doi: 10.52403/ijshr.20210438
    OpenUrlCrossRef
  38. ↵
    Paul P, Iyer S, Nadella RK, Nayak R, Chellappa AS, Ambardar S, Sud R, Sukumaran SK, Purushottam M, Jain S, Rao NP, Narayanaswamy JC, Sivakumar PT, Kandasamy A, Kesavan M, Mehta UM, Venkatasubramanian G, John JP, Mukherjee O, Kannan R, Mehta B, Kandavel T, Binukumar B, Saini J, Jayarajan D, Shyamsundar A, Moirangthem S, Kumar KGV, Thirthalli J, Chandra PS, Gangadhar BN, Murthy P, Panicker MM, Bhalla US, Chattarji S, Benegal V, Varghese M, Reddy JYC, Raghu P, Rao M, Viswanath B. (2020). Lithium response in bipolar disorder correlates with improved cell viability of patient derived cell lines. Sci. Rep. 10, 1–10. doi: 10.1038/s41598-020-64202-1
    OpenUrlCrossRefPubMed
  39. De Peri L, Crescini A, Deste G, Fusar-Poli P, Sacchetti E, Vita A. (2012.) Brain Structural Abnormalities at the Onset of Schizophrenia and Bipolar Disorder: A Meta-analysis of controlled magnetic resonance imaging studies. Curr. Pharm. Des. 18, 486–494. doi: 10.2174/138161212799316253
    OpenUrlCrossRefPubMed
  40. ↵
    Rahimi-Balaei M, Bergen H, Kong J, Marzban H. (2018). Neuronal migration during development of the cerebellum. Front. Cell. Neurosci. 12, 1–16. doi: 10.3389/fncel.2018.00484
    OpenUrlCrossRef
  41. ↵
    Ritch PA, Carroll SL, Sontheimer H. (2003). Neuregulin-1 enhances motility and migration of human astrocytic glioma cells. J. Biol. Chem. 278, 20971–20978. doi: 10.1074/jbc.M213074200
    OpenUrlAbstract/FREE Full Text
  42. Schmidt M, Dekker FJ, Maarsingh H. (2013). Exchange protein directly activated by cAMP (epac): A multidomain cAMP mediator in the regulation of diverse biological functions. Pharmacol. Rev. 65, 670–709. doi: 10.1124/pr.110.003707
    OpenUrlAbstract/FREE Full Text
  43. Seo H, Lee K. (2019). Cell-specific expression of Epac2 in the subventricular and subgranular zones. Mol. Brain 12, 10–13. doi: 10.1186/s13041-019-0537-1
    OpenUrlCrossRef
  44. ↵
    Simpson KJ, Selfors LM, Bui J, Reynolds A, Leake D, Khvorova A, Brugge JS. (2008). Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nat. Cell Biol. 10, 1027–1038. doi: 10.1038/ncb1762
    OpenUrlCrossRefPubMedWeb of Science
  45. ↵
    Silva, C. G., Peyre, E., Nguyen, L. (2019). Cell migration promotes dynamic cellular interactions to control cerebral cortex morphogenesis. Nature Reviews Neuroscience, 20(6), 318–329. doi: 10.1038/s41583-019-0148-y
    OpenUrlCrossRefPubMed
  46. ↵
    Snel B, Lehmann G, Bork P, Huynen MA. (2000). String: A web-server to retrieve and display the repeatedly occurring neighbourhood of a gene. Nucleic Acids Res. 28, 3442–3444. doi: 10.1093/nar/28.18.3442
    OpenUrlCrossRefPubMedWeb of Science
  47. ↵
    Suyama E, Kawasaki H, Kasaoka T, Taira K. (2003). Identification of genes responsible for cell migration by a library of randomized ribozymes. Cancer Res. 63, 119–124.
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, Simonovic M, Doncheva NT, Morris JH, Bork P, Jensen LJ, Von Mering C. (2019). STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47, D607–D613. doi: 10.1093/nar/gky1131
    OpenUrlCrossRefPubMed
  49. Tabarés-Seisdedos R, Escámez T, Martínez-Giménez JA, Balanzá V, Salazar J, Selva G, Rubio C, Vieta E, Geijó-Barrientos E, Martínez-Arán A, Reiner O, Martínez S. (2006). Variations in genes regulating neuronal migration predict reduced prefrontal cognition in schizophrenia and bipolar subjects from mediterranean Spain: A preliminary study. Neuroscience 139, 1289–1300. doi: 10.1016/j.neuroscience.2006.01.054
    OpenUrlCrossRefPubMedWeb of Science
  50. Tanaka DH, Maekawa K, Yanagawa Y, Obata K, Murakami F. (2006). Multidirectional and multizonal tangential migration of GABAergic interneurons in the developing cerebral cortex. Development 133, 2167–2176. doi: 10.1242/dev.02382
    OpenUrlAbstract/FREE Full Text
  51. ↵
    Van Rheenen TE, Lewandowski KE, Bauer IE, Kapczinski F, Miskowiak K, Burdick KE, Balanzá-Martínez V. (2020). Current understandings of the trajectory and emerging correlates of cognitive impairment in bipolar disorder: An overview of evidence. Bipolar Disord. 22(1),13–27. doi: 10.1111/bdi.12821.
    OpenUrlCrossRef
  52. ↵
    Vasistha NA, Johnstone M, Barton SK, Mayerl SE, Thangaraj Selvaraj B, Thomson PA, Dando O, Grünewald E, Alloza C, Bastin ME, Livesey MR, Economides K, Magnani D, Makedonopolou P, Burr K, Story DJ, Blackwood DHR, Wyllie DJA, McIntosh AM, Millar JK, Ffrench-Constant C, Hardingham GE, Lawrie SM, Chandran S. (2019). Familial t(1;11) translocation is associated with disruption of white matter structural integrity and oligodendrocyte-myelin dysfunction. Mol Psychiatry. 24(11),1641–1654. doi: 10.1038/s41380-019-0505-2
    OpenUrlCrossRef
  53. ↵
    Viswanath B, Rao NP, Narayanaswamy JC, Sivakumar PT, Kandasamy A, Kesavan M, Mehta UM, Venkatasubramanian G, John JP, Mukherjee O, Purushottam M, Kannan R, Mehta B, Kandavel T, Binukumar B, Saini J, Jayarajan D, Shyamsundar A, Moirangthem S, Vijay Kumar KG, Thirthalli J, Chandra PS, Gangadhar BN, Murthy P, Panicker MM, Bhalla US, Chattarji S, Benegal V, Varghese M, Reddy JYC, Raghu P, Rao M, Jain S. (2018). Discovery biology of neuropsychiatric syndromes (DBNS): A center for integrating clinical medicine and basic science. BMC Psychiatry 18, 106. doi: 10.1186/s12888-018-1674-2
    OpenUrlCrossRef
  54. Vonk R, van der Schot AC, van Baal GCM, van Oel CJ, Nolen WA, Kahn RS. (2014). Dermatoglyphics in relation to brain volumes in twins concordant and discordant for bipolar disorder. Eur. Neuropsychopharmacol. 24, 1885–1895. doi: 10.1016/j.euroneuro.2014.09.010
    OpenUrlCrossRef
  55. ↵
    Wu X, Kodama A, Fuchs E. (2008). ACF7 regulates cytoskeletal-focal adhesion dynamics and migration and has ATPase activity. Cell 135, 137–148. doi: 10.1016/j.cell.2008.07.045
    OpenUrlCrossRefPubMedWeb of Science
  56. Yanagida M, Miyoshi R, Toyokuni R, Zhu Y, Murakami F. (2012). Dynamics of the leading process, nucleus, and Golgi apparatus of migrating cortical interneurons in living mouse embryos. Proc. Natl. Acad. Sci. U. S. A. 109, 16737–16742. doi: 10.1073/pnas.1209166109
    OpenUrlAbstract/FREE Full Text
  57. ↵
    Yang H, Robinson PN, Wang K. (2015). Phenolyzer: phenotype-based prioritization of candidate genes for human diseases. Nat Methods. 12(9), 841–3. doi: 10.1038/nmeth.3484
    OpenUrlCrossRefPubMed
  58. Yazawa M, Dolmetsch RE. (2013). Modeling timothy syndrome with iPS cells. J. Cardiovasc. Transl. Res. 6: 1–9. doi: 10.1007/s12265-012-9444-x
    OpenUrlCrossRefPubMed
  59. ↵
    Zinner M, Lukonin I, Liberali P. (2020). Design principles of tissue organisation: How single cells coordinate across scales. Curr Opin Cell Biol. 67, 37–45. doi: 10.1016/j.ceb.2020.07.004
    OpenUrlCrossRef
Back to top
Posted October 27, 2021.
Download PDF

Supplementary Material

Data/Code
Email
Dysregulation in EGF/ERBB signaling pathway may explain abnormalities of neural precursor migration in bipolar disorder
Salil K. Sukumaran, Pradip Paul, Vishwesha Guttal, Bharath Holla, Alekhya Vemula, Harsimar Bhatt, Piyush Bisht, Kezia Mathew, Ravi K Nadella, Anu Mary Varghese, K Vijayalakshmi, Meera Purushottam, Sanjeev Jain, ADBS Consortium, Reeteka Sud, Biju Viswanath
medRxiv 2021.04.22.21254208; doi: https://doi.org/10.1101/2021.04.22.21254208
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area