Skip to main content
medRxiv
  • Home
  • About
  • Submit
  • ALERTS / RSS
Advanced Search

An accurate and rapid Real-time PCR approach for human Monkeypox virus diagnosis

Tony Wawina-Bokalanga, Nikola Sklenovska, Bert Vanmechelen, Mandy Bloemen, Valentijn Vergote, Lies Laenen, Emmanuel André, Marc Van Ranst, Jean-Jacques Muyembe-Tamfum, Piet Maes
doi: https://doi.org/10.1101/2022.06.23.22276033
Tony Wawina-Bokalanga
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Nikola Sklenovska
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Bert Vanmechelen
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mandy Bloemen
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Valentijn Vergote
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lies Laenen
2Department of Laboratory Medicine and National Reference Center for Respiratory Pathogens, University Hospitals Leuven, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Emmanuel André
2Department of Laboratory Medicine and National Reference Center for Respiratory Pathogens, University Hospitals Leuven, 3000 Leuven, Belgium
3KU Leuven, Laboratory of Clinical Microbiology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Marc Van Ranst
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
2Department of Laboratory Medicine and National Reference Center for Respiratory Pathogens, University Hospitals Leuven, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jean-Jacques Muyembe-Tamfum
4Institut National de Recherche Biomédicale (INRB), Kinshasa, Democratic Republic of the Congo
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Piet Maes
1KU Leuven, Rega Institute Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical and Epidemiological Virology, 3000 Leuven, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: piet.maes{at}kuleuven.be
  • Abstract
  • Full Text
  • Info/History
  • Metrics
  • Data/Code
  • Preview PDF
Loading

ABSTRACT

Background Human monkeypox (MPX) is an emerging zoonotic disease caused by monkeypox virus (MPXV), which is endemic to Western and Central Africa. Despite being identified in captive monkeys in 1958, and in humans from the Democratic Republic of Congo (DRC) in 1970, a MPXV diagnostic test is not routinely implemented in diagnostic laboratories. Currently, a multi-country outbreak of MPXV has been ongoing in several European and American countries since May 2022.

Methods To develop this real-time PCR assay, five MPXV positive DNA samples were tested using MPXV-specific primers. The qPCR amplification was conducted on two different qPCR devices. We also tested samples, collected in May 2022, from pox-like lesions of MPXV-suspected patients in Belgium.

Results The performance of our real-time PCR was proved with five MPXV positive DNA from DRC. In addition, five out of ten clinical samples, from the current MPXV-outbreak, tested positive with Ct values ranging from 20.6 to 34.9.

Conclusions In this study, we present an accurate and rapid real-time PCR approach, based on conserved regions of both MPXV clades, that can be used to test clinical samples from MPXV-suspected persons. Our real-time qPCR assay can be used for the 2022 multi-country outbreak of human MPXV.

Summary An accurate and fast real-time PCR assay is indispensable to diagnose cases of monkeypox during the 2022 multi-country outbreak.

INTRODUCTION

Monkeypox virus (MPXV) is a double-stranded DNA virus that belongs to the genus Orthopoxvirus within the family Poxviridae, subfamily Chordopoxvirinae. This genus consists of 12 different species of which four contain viruses that are pathogenic to human: Monkeypox virus, Vaccinia virus, Cowpox virus, and Variola virus. The latter is the causative agent of smallpox, a disease which has been globally eradicated since 1977 [1, 2].

Following the first reported cases of human monkeypox infections in 1970 in the Democratic Republic of Congo (DRC, formerly Zaïre), other human MPXV outbreaks have been reported in Central and West Africa [3]. In 2003, the United States of America (USA) experienced a human MPXV outbreak in multiple states, the first one in the Western Hemisphere [4, 5]. In addition, monkeypox infections have been reported in travelers from Nigeria to Israel (September 2018), to the United Kingdom (September 2018, December 2019, and May 2021), to Singapore (May 2019), and to the USA (July and November 2021) [6-8].

From May 2022, a multi-country outbreak of MPXV has been ongoing in several countries, primarily in Europe and the Americas. The first cases of this outbreak were mainly but not exclusively identified amongst men who have sex with men seeking treatment in primary care and sexual health clinics [9].

Despite being identified in captive monkeys already in 1958, and in humans from DRC in 1970, there is no certified MPXV in-vitro diagnostic (IVD) kit that can be used for human MPXV detection. Furthermore, the lack of certified MPXV IVD kits could negatively impact the surveillance of MPXV transmission in the community. Therefore, different PCR methods mainly based on real-time PCR have been proposed and used in monkeypox endemic regions [10-13].

Human monkeypox infection is endemic in West and Central African countries, where MPXV remains the most pathogenic poxvirus. The case fatality rate in Africa varies between 1 and 11% depending on the MPXV clade, the surveillance system and health care infrastructures [14, 15].

MPXV-infection is characterized by a 1-to 4-day prodromal period (with fever and malaise) before development of skin rashes with indurated and umbilicated lesions, starting on the head or face and progressing to the limbs and trunk (Table 1) [16, 17].

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table 1.

WHO case definition[18]

Furthermore, the rising number of MPXV-infected people over the last years can be associated with cessation of routine vaccination against smallpox, which increased human vulnerability to MPXV [19].

Prior to the current outbreak, our laboratory had developed an accurate and rapid real-time PCR approach that can be used for human MPXV diagnosis. In this report, we show the validation of this approach and illustrate its employability as a diagnostic tool for the current MPXV outbreak.

METHODS

Sample collection

Five MPXV positive DNA samples collected in 2016 were kindly provided by the Institut National de Recherche Biomédicale (INRB), Kinshasa (DRC). These DNA samples were extracted locally at INRB from skin lesions of MPXV-infected patients.

Viral DNA from the pox-like lesions of MPXV-suspected patients in Belgium, collected in May 2022, was extracted using the MagMax viral pathogen II nucleic acid isolation kit for KingFisher™Flex system (ThermoFisher).

Primer and probe design

Selection of MPXV-specific primers and hybridization probes was performed based on the sequence of a selection of MPXV genomes from the Central Africa clade, which were retrieved from the GenBank database and multiple-aligned using MUSCLE in MEGA v7.0 [20].

Open reading frame O2L (662 bp in length), one of the conserved regions of MPXV genomes, was used as a template for designing the specific primers and probes through the Integrated DNA Technologies, PrimerQuest™tool [21].

Oligonucleotide primers and corresponding hybridization probes were checked for self-complementarity and optimal melting temperature using the online program Oligo Calc [22]. The MPXV-specific probe contained the 6-FAM/ZEN-IBFQ dye/quencher pair, which has a maximum emission wavelength of 518 nm (Table 2).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table 2.

Validated MPXV-specific primers and probe

Real-time PCR amplification

PCR amplification was conducted on Mic qPCR (Bio Molecular systems) and AB™7500 Fast Real-Time PCR system (Applied Biosystems, USA) devices. Reactions were performed using a 20 µl reaction mixture containing 5 µl 4x TaqMan™Fast Virus 1-Step Master Mix, 900 nM of each forward and reverse primers, 250 nM probe, and 5 µl DNA template. Each qPCR reaction was performed in duplicate. PCR reactions were performed under the following conditions: 20 sec at 95°C and 45 cycles of 3 sec at 95°C and 30 sec at 60°C (Fast Mode).

Confirmation through Sanger sequencing

The PCR products were purified using the ExoSAP-IT kit (Applied Biosystems, USA). Cycle sequencing of the purified PCR products was performed using BigDye Terminator chemistry (Applied Biosystems, USA). Sequencing reactions were purified with a rapid in-house method using 1:10 volume sodium acetate (3M, pH 5,5) mixed with 70% ethanol. The purified sequencing products were run on ABI PRISM 3100 (Applied Biosystems, USA). Sequences were analyzed and corrected using SeqMan software, version 7.0.0. To confirm the specificity of our primers, the obtained sequences were compared to a MPXV reference genome using BLAST tool [23].

Analysis of clinical samples from the ongoing human MPXV outbreak

Clinical samples (pox-like lesions) from MPXV-suspected patients were collected by physicians then transported safely to the laboratory in accordance with national and international requirements. Viral DNA was extracted using MagMax viral pathogen II nucleic acid isolation kit for KingFisher™Flex system (ThermoFisher).

PCR amplification was conducted on QuantStudio™7 Flex Real-Time PCR System. Reactions were performed using a 20 µl reaction mixture 5 µL TaqMan™Fast Virus 1-Step Master Mix (Applied Biosystems, Cat 4444434), 900 nM of each forward and reverse primers, 0,5 µL probe, 7,5 µL RNase free water and 5 µL DNA template. Each qPCR reaction was performed in duplicate under the PCR conditions mentioned previously (Figure 1).

Figure 1.
  • Download figure
  • Open in new tab
Figure 1.

PCR conditions for MPXV diagnosis on QuantStudio™7 Flex RT PCR System

Ethics

Ethical permission for the work conducted at KU Leuven on the viral DNA samples was approved by the KU Leuven ethics committee under reference no. S58836.

RESULTS

Real-time PCR assay on AB™7500 Fast Real-Time PCR system

All five MPXV DNA samples used for assay development were positive with a cycle threshold value (Ct) ranging from 15.3 to 24.6 (Figure 2).

Figure 2.
  • Download figure
  • Open in new tab
Figure 2.

Δ Rn vs cycle representation of the real-time PCR performed on an AB™7500 Fast Real-Time PCR system. Data were obtained using the 7500 Fast System Software v1.3.1 with primers and hybridization probe calculated for MPXV. The detection signal of 6-FAM dye conjugated with MPXV-probe is 518 nm.

PCR assay on Mic qPCR cycler

To assess the sensitivity of our RT-PCR assay, we performed 10-fold serial dilutions of each positive MPXV-DNA sample on a Mic qPCR cycler and the results were analyzed using the MicPCR Software v2.2.0. As seen on the AB™7500 Fast Real-Time PCR system, all dilutions from each positive MPXV-DNA sample were confirmed to be MPXV-positive with Ct values ranging from 15.3 to 22.3 (Figure 3).

Figure 3.
  • Download figure
  • Open in new tab
Figure 3.

Δ Rn vs cycle representation of the qPCR performed on the MIC cycler. MPXV PCR amplification curves from successive 10-fold serial dilutions of a positive sample with Ct values ranging from 15.3 to 22.3.

Validation of our primers and probe for the current outbreak strain

To confirm the specificity of our primers and probe, a BLAST search was performed against all available genomes of both MPXV clades, including sequences from the recent outbreak. The query coverage and maximum identity of our primers were 100% for both MPXV clades. However, a single mismatch (ACCGGTAATCTTGTCGATGAGGACA) with genomes of the West African clade, including those from the current outbreak, was observed in the probe.

To validate whether the qPCR assay was still efficient, we conducted our qPCR on a 5-fold serial dilution series of a MPXV-suspected sample from the ongoing multi-country outbreak. A DNA sample from the second reported case of MPXV-infection in Belgium was used and all serial dilutions were confirmed MPXV positive, with Ct values ranging from 16.5 to 37.3 as shown in Figure 4.

Figure 4.
  • Download figure
  • Open in new tab
Figure 4.

Δ Rn vs cycle representation of the qPCR performed on the QuantStudio™7 Flex Real-Time PCR System. MPXV PCR amplification curves from successive 5-fold serial dilutions of a positive sample with Ct values ranging from 16.5 to 37.3.

Figure 5.
  • Download figure
  • Open in new tab
Figure 5.

Δ Rn vs cycle representation of the qPCR performed on the QuantStudio™7 Flex Real-Time PCR System. PCR amplification curves of DNA samples from the ongoing human MPXV-outbreak, which started in May 2022. 1: Positive control, 2-6: Clinical DNA samples.

Following this initial sample, an additional ten MPXV-suspected samples were tested using our qPCR. Five out of ten clinical samples tested positive, with Ct values ranging from 20.6 to 34.9.

CONCLUSION

In this study, we confirmed the usability of a previously in-house developed qPCR assay for the diagnosis of MPXV-infected samples. The initial assay validation was performed on both the Mic qPCR and AB™7500 Fast Real-Time PCR systems. The used primers are specific for all known MPXV genomes, and while the probe contains a single mismatch with the currently circulating strain, it can still reliably detect viruses of both the Central and West Africa MPXV clades, including the clade that is currently circulating in Europe.

In summary, this qPCR assay has been proven to be MPXV-specific, highly efficient and rapid. Furthermore, it can be used for the 2022 multi-country outbreak of MPXV.

Data Availability

All data produced in the present study are available upon reasonable request to the authors

Author Contributions

First draft preparation: TWB. Conceptualization and investigation: TWB, NS, MB, VV, MVR, PM. Writing-review and editing: TWB, NS, BV, LL, EA, JJMT, and PM. All authors have read and approved the final version of the manuscript.

Funding

This research received no specific project grant.

Potential conflicts of interest

The authors declare that they have no conflict of interest.

Acknowledgements

The authors thank the Institut National de Recherche Biomédicale (INRB), through Professor J.J Muyembe Tamfum, for providing the positive MPXV-DNA samples.

Reference

  1. 1.↵
    International Committee on Taxonomy of Viruses (ICTV). 9th Report (2011). Poxviridae - Figures [accessed May 24, 2022]. Available from: https://talk.ictvonline.org/ictv-reports/ictv_9th_report/dsdna-viruses-2011/w/dsdna_viruses/75/poxviridae-figures.
  2. 2.↵
    Marennikova SS, Moyer RW. Classification of Poxviruses and Brief Characterization of the Genus Orthopoxvirus. 2005. In: Orthopoxviruses Pathogenic for Humans [Internet]. Springer, Boston, MA; [pp 11–8].
  3. 3.↵
    Durski KN, McCollum AM, Nakazawa Y, Petersen BW, Reynolds MG, Briand S, et al. Emergence of Monkeypox - West and Central Africa, 1970-2017. MMWR Morb Mortal Wkly Rep. 2018;67(10):306–10. Epub 2018/03/16. doi: 10.15585/mmwr.mm6710a5. PubMed PMID: 29543790; PubMed Central PMCID: PMCPMC5857192.
    OpenUrlCrossRefPubMed
  4. 4.↵
    Centers for Disease C, Prevention. Update: multistate outbreak of monkeypox--Illinois, Indiana, Kansas, Missouri, Ohio, and Wisconsin, 2003. MMWR Morb Mortal Wkly Rep. 2003;52(27):642–6. Epub 2003/07/12. PubMed PMID: 12855947.
    OpenUrlPubMed
  5. 5.↵
    Reed KD, Melski JW, Graham MB, Regnery RL, Sotir MJ, Wegner MV, et al. The detection of monkeypox in humans in the Western Hemisphere. N Engl J Med. 2004;350(4):342–50. Epub 2004/01/23. doi: 10.1056/NEJMoa032299. PubMed PMID: 14736926.
    OpenUrlCrossRefPubMedWeb of Science
  6. 6.↵
    Vaughan A, Aarons E, Astbury J, Balasegaram S, Beadsworth M, Beck CR, et al. Two cases of monkeypox imported to the United Kingdom, September 2018. Euro Surveill. 2018;23(38). Epub 2018/09/27. doi: 10.2807/1560-7917.ES.2018.23.38.1800509. PubMed PMID: 30255836; PubMed Central PMCID: PMCPMC6157091.
    OpenUrlCrossRefPubMed
  7. 7.
    Mauldin MR, McCollum AM, Nakazawa YJ, Mandra A, Whitehouse ER, Davidson W, et al. Exportation of Monkeypox Virus From the African Continent. J Infect Dis. 2022;225(8):1367–76. Epub 2020/09/04. doi: 10.1093/infdis/jiaa559. PubMed PMID: 32880628; PubMed Central PMCID: PMCPMC9016419.
    OpenUrlCrossRefPubMed
  8. 8.↵
    Centers for Disease Control and Prevention. Monkeypox in the United States 2022 [accessed on June 03, 2022]. Available from: https://www.cdc.gov/poxvirus/monkeypox/outbreak/us-outbreaks.html.
  9. 9.↵
    World Health Organization. Multi-country monkeypox outbreak in non-endemic countries. 2022, [accessed May 24, 2022]. Available from: https://www.who.int/emergencies/disease-outbreak-news/item/2022-DON385.
  10. 10.↵
    Kulesh DA, Loveless BM, Norwood D, Garrison J, Whitehouse CA, Hartmann C, et al. Monkeypox virus detection in rodents using real-time 3’-minor groove binder TaqMan assays on the Roche LightCycler. Lab Invest. 2004;84(9):1200–8. Epub 2004/06/23. doi: 10.1038/labinvest.3700143. PubMed PMID: 15208646.
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.
    Li Y, Olson VA, Laue T, Laker MT, Damon IK. Detection of monkeypox virus with real-time PCR assays. J Clin Virol. 2006;36(3):194–203. Epub 2006/05/30. doi: 10.1016/j.jcv.2006.03.012. PubMed PMID: 16731033.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.
    Li Y, Zhao H, Wilkins K, Hughes C, Damon IK. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA. J Virol Methods. 2010;169(1):223–7. Epub 2010/07/21. doi: 10.1016/j.jviromet.2010.07.012. PubMed PMID: 20643162.
    OpenUrlCrossRefPubMedWeb of Science
  13. 13.↵
    Shchelkunov SN, Shcherbakov DN, Maksyutov RA, Gavrilova EV. Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex real-time PCR assay. J Virol Methods. 2011;175(2):163–9. Epub 2011/06/04. doi: 10.1016/j.jviromet.2011.05.002. PubMed PMID: 21635922.
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.↵
    Kabuga AI, El Zowalaty ME. A review of the monkeypox virus and a recent outbreak of skin rash disease in Nigeria. J Med Virol. 2019;91(4):533–40. Epub 2018/10/26. doi: 10.1002/jmv.25348. PubMed PMID: 30357851.
    OpenUrlCrossRefPubMed
  15. 15.↵
    Beer EM, Rao VB. A systematic review of the epidemiology of human monkeypox outbreaks and implications for outbreak strategy. PLoS Negl Trop Dis. 2019;13(10):e0007791. Epub 2019/10/17. doi: 10.1371/journal.pntd.0007791. PubMed PMID: 31618206; PubMed Central PMCID: PMCPMC6816577.
    OpenUrlCrossRefPubMed
  16. 16.↵
    Di Giulio DB, Eckburg PB. Human monkeypox: an emerging zoonosis. Lancet Infect Dis. 2004;4(1):15–25. Epub 2004/01/15. doi: 10.1016/s1473-3099(03)00856-9. PubMed PMID: 14720564.
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    World Health Organization. Laboratory testing for the monkeypox virus: Interim guidance. 2022, [accessed May 24, 2022]. Available from: https://www.who.int/publications/i/item/WHO-MPX-laboratory-2022.1.
  18. 18.↵
    World Health Organization. Monkeypox Outbreak Toolbox. 2022, [accessed May 24, 2022.]. Available from: https://www.who.int/emergencies/outbreak-toolkit/disease-outbreak-toolboxes/monkeypox-outbreak-toolbox.
  19. 19.↵
    Jahrling PB, Huggins JW, Ibrahim MS, Lawler JV, Martin JW. Smallpox and related orthopoxviruses. [cited on June 1st, 2022.]. In: Textbooks of Military Medicine Medical Aspects of Biological Warfare [Internet]. Published by the Office of The Surgeon General: Borden Institute, Washington DC 2007, [cited on June 1st, 2022.]. Available from: https://documents.theblackvault.com/documents/biological/MedAspectsBio.pdf.
  20. 20.↵
    Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870–4. Epub 2016/03/24. doi: 10.1093/molbev/msw054. PubMed PMID: 27004904; PubMed Central PMCID: PMCPMC8210823.
    OpenUrlCrossRefPubMed
  21. 21.↵
    Integrated DNA Technologies. PrimerQuest™ Tool. [accessed in 2017]. Available from: https://eu.idtdna.com/pages/tools/primerquest.
  22. 22.↵
    Kibbe WA. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007;35(Web Server issue):W43–6. Epub 2007/04/25. doi: 10.1093/nar/gkm234. PubMed PMID: 17452344; PubMed Central PMCID: PMCPMC1933198.
    OpenUrlCrossRefPubMedWeb of Science
  23. 23.↵
    Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–10. Epub 1990/10/05. doi: 10.1016/S0022-2836(05)80360-2. PubMed PMID: 2231712.
    OpenUrlCrossRefPubMedWeb of Science
Back to top
PreviousNext
Posted June 23, 2022.
Download PDF
Data/Code
Email

Thank you for your interest in spreading the word about medRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Enter multiple addresses on separate lines or separate them with commas.
An accurate and rapid Real-time PCR approach for human Monkeypox virus diagnosis
(Your Name) has forwarded a page to you from medRxiv
(Your Name) thought you would like to see this page from the medRxiv website.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
An accurate and rapid Real-time PCR approach for human Monkeypox virus diagnosis
Tony Wawina-Bokalanga, Nikola Sklenovska, Bert Vanmechelen, Mandy Bloemen, Valentijn Vergote, Lies Laenen, Emmanuel André, Marc Van Ranst, Jean-Jacques Muyembe-Tamfum, Piet Maes
medRxiv 2022.06.23.22276033; doi: https://doi.org/10.1101/2022.06.23.22276033
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools
An accurate and rapid Real-time PCR approach for human Monkeypox virus diagnosis
Tony Wawina-Bokalanga, Nikola Sklenovska, Bert Vanmechelen, Mandy Bloemen, Valentijn Vergote, Lies Laenen, Emmanuel André, Marc Van Ranst, Jean-Jacques Muyembe-Tamfum, Piet Maes
medRxiv 2022.06.23.22276033; doi: https://doi.org/10.1101/2022.06.23.22276033

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Subject Area

  • Infectious Diseases (except HIV/AIDS)
Subject Areas
All Articles
  • Addiction Medicine (349)
  • Allergy and Immunology (668)
  • Allergy and Immunology (668)
  • Anesthesia (181)
  • Cardiovascular Medicine (2648)
  • Dentistry and Oral Medicine (316)
  • Dermatology (223)
  • Emergency Medicine (399)
  • Endocrinology (including Diabetes Mellitus and Metabolic Disease) (942)
  • Epidemiology (12228)
  • Forensic Medicine (10)
  • Gastroenterology (759)
  • Genetic and Genomic Medicine (4103)
  • Geriatric Medicine (387)
  • Health Economics (680)
  • Health Informatics (2657)
  • Health Policy (1005)
  • Health Systems and Quality Improvement (985)
  • Hematology (363)
  • HIV/AIDS (851)
  • Infectious Diseases (except HIV/AIDS) (13695)
  • Intensive Care and Critical Care Medicine (797)
  • Medical Education (399)
  • Medical Ethics (109)
  • Nephrology (436)
  • Neurology (3882)
  • Nursing (209)
  • Nutrition (577)
  • Obstetrics and Gynecology (739)
  • Occupational and Environmental Health (695)
  • Oncology (2030)
  • Ophthalmology (585)
  • Orthopedics (240)
  • Otolaryngology (306)
  • Pain Medicine (250)
  • Palliative Medicine (75)
  • Pathology (473)
  • Pediatrics (1115)
  • Pharmacology and Therapeutics (466)
  • Primary Care Research (452)
  • Psychiatry and Clinical Psychology (3432)
  • Public and Global Health (6527)
  • Radiology and Imaging (1403)
  • Rehabilitation Medicine and Physical Therapy (814)
  • Respiratory Medicine (871)
  • Rheumatology (409)
  • Sexual and Reproductive Health (410)
  • Sports Medicine (342)
  • Surgery (448)
  • Toxicology (53)
  • Transplantation (185)
  • Urology (165)