Skip to main content
medRxiv
  • Home
  • About
  • Submit
  • ALERTS / RSS
Advanced Search

A novel mutation in EROS (CYBC1) causes Chronic Granulomatous Disease

Paige M Mortimer, Esme Nichols, Joe Thomas, Rachna Shanbhag, Neha Singh, Eve L Coomber, Talat H Malik, Matthew C Pickering, Lyra Randzavola, William Rae, Sagar Bhattad, David C Thomas
doi: https://doi.org/10.1101/2023.04.21.23286144
Paige M Mortimer
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Esme Nichols
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joe Thomas
2Aster Medcity Hospital, Kochi, Kerala, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rachna Shanbhag
3Aster CMI Hospital, Bangalore, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Neha Singh
3Aster CMI Hospital, Bangalore, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Eve L Coomber
4Wellcome Sanger Institute, Hinxton, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Talat H Malik
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Matthew C Pickering
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lyra Randzavola
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
William Rae
5Clinical Development, Late Respiratory and Immunology, BioPharmaceuticals R and D, AstraZeneca, Cambridge, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sagar Bhattad
3Aster CMI Hospital, Bangalore, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
David C Thomas
1Centre for Inflammatory Disease, Department of Immunology and Inflammation, Imperial College London, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: david.thomas1{at}imperial.ac.uk
  • Abstract
  • Full Text
  • Info/History
  • Metrics
  • Data/Code
  • Preview PDF
Loading

Abstract

Chronic Granulomatous Disease (CGD) is an inborn error of immunity characterised by opportunistic infection and sterile granulomatous inflammation. CGD is caused by a failure of reactive oxygen species (ROS) production by the phagocyte NADPH oxidase. Mutations in the genes encoding phagocyte NADPH oxidase subunits cause CGD. We and others have described a novel form of CGD (CGD5) secondary to lack of EROS (CYBC1), a highly selective chaperone for gp91phox. EROS-deficient cells express minimal levels of gp91phox and its binding partner p22phox, but EROS also controls the expression of other proteins such as P2×7. The full nature of CGD5 is currently unknown. We describe a homozygous frameshift mutation in CYBC1 leading to CGD. Individuals who are heterozygous for this mutation are found in South Asian populations (allele frequency = 0.00006545), thus it is not a private mutation. Therefore, it is likely to be the underlying cause of other cases of CGD.

Introduction

The multi-subunit phagocyte NADPH oxidase generates reactive oxygen species (ROS) and is crucial for host defence 1. Deficiencies in individual subunits (gp91phox, p22phox, p47phox, p67phox and p40phox) of the phagocyte NADPH oxidase cause chronic granulomatous disease (CGD), a severe inborn error of immunity (IEI) characterised by severe infections with catalase positive organisms. Life threatening infections with Staphylococcus, Salmonella species, Burkholdheria and nocardia are all well documented. Fungal infections with species such as Aspergillus are also common and are associated with severe morbidity. While better anti-microbial prophylaxis and treatment accompanied by the advent of bone marrow transplantation for CGD has improved outcomes, it remains a severe disease that requires prompt identification and treatment. We previously showed that EROS/CYBC1 is essential for the generation of ROS because it is the chaperone for the membrane-bound gp91phox-p22phox heterodimer in both mouse and humans 2–4. We and others have shown that mutations in EROS/CYBC1 can cause CGD5 3,5. The small number of cases described so far appear to have some typical features of CGD, such as opportunistic infections and inflammatory bowel disease, but also some features not usually associated with CGD including; autoimmune haemolytic anaemia, chronic glomerulonephritis and even some viral infections. Thus far, the only pathogenic EROS/CYBC1 mutations identified are private mutations restricted to one family 3 (as a result of consanguineous marriage) or are limited to the Icelandic population 5. We describe a novel pathogenic mutation in EROS/CYBC1 that is likely to account for more cases worldwide as awareness of CGD5 grows.

Results/Case History

A female in her twenties has been unwell for three years. Her childhood history is notable for tuberculosis in the first five years of life and an episode of uveitis during teenage years, which resolved following topical steroid treatment. She was otherwise well. At the onset of symptoms she developed a prolonged cough and fever. She was treated for radiographically proven pneumonia (Figure 1A) and responded to oral antibiotics. However, she developed a dry cough and shortness of breath 3 months later. Two weeks into the illness, she developed a rash over the trunk, dry mouth and swelling of her cervical lymph nodes. A biopsy of the skin rash showed erythema annulare centrifugum and fine needle aspiration cytology of the neck nodes showed granulomatous lesions. Testing by Mantoux and TB gold was negative. A CT scan of her chest showed upper zone nodules and ground glass opacities. ACE2 was elevated at 122 (12-68 units/ml). With a working diagnosis of sarcoidosis she was started on prednisolone (40 mg) and her respiratory symptoms, rash and neck nodes resolved. The steroids were gradually tapered, and methotrexate was added but then stopped due to liver dysfunction.

Figure 1:
  • Download figure
  • Open in new tab
Figure 1: Clinical history of the patient

(A) Chest x-ray of pneumonia. (B) PET CT scan of a large necrotic lesion in the right lung with infiltration into the pleura. (C) CT scan of right 7th rib osteomyelitis near previous surgical wound. (D) Dematiaceous fungi growth from excised rib. (E) Timeline of the patient’s clinical course.

Between 4 and 7-months post-onset she was admitted to hospital three times for episodes of dry cough and shortness of breath. She developed fever and chest pain when steroids were reduced to 15 mg daily. A new CT chest showed traction bronchiectasis, multiple peri-lymphatic and parenchymal nodules and a minimal right pleural effusion. Bronchoalveolar lavage was negative for a TB panel, fungal stain and culture. Given the complexity of her presentation, a PET CT was undertaken. It showed a large necrotic lesion in the right lung with infiltration into the pleura (Figure 1B). A segmental resection of the involved lung by transthoracic surgery was carried out. This demonstrated dematiaceous fungi (Malasezzia restricta). She was treated with amphotericin B and steroids were continued. A blood culture at this time also demonstrated methicillin resistant coagulase negative staphylococci. During this period, she had ongoing liver dysfunction and a liver biopsy showed granulomatous hepatitis. She then developed fever and infection with Salmonella species was found on blood culture. A bone marrow culture also reported Salmonella species. A bone marrow biopsy showed granulomatous infiltration. In view of the granulomatous infiltration in multiple organs, anti-tubercular therapy (ATT) was started. She had ongoing fevers in the next month, despite four weeks treatment with amphotericin and hence, amphotericin was stopped. Her dose of steroid was increased to 1mg/kg prednisolone. With a combination of steroids and ATT, there was resolution of fever and cough.

At 12 months from onset, the surgical wound caused by the lung biopsy failed to heal and there was intermittent pus discharge from the wound. At this time, culture from the wound showed growth of Mycobacterium tuberculosis (45-day culture) and therapy was changed from modified ATT (in view of hepatitis and concurrent Voriconazole treatment) to standard ATT (6 months modified ATT followed by 9 months standard ATT), following which the wound healed. However, on reducing steroids there was recurrence of fever. Steroid sparing agents like mycophenolate mofetil and azathioprine were trialled, with no response. She also developed cushingoid features hence injected anti-TNF-α therapy (Adalimumab) was started 11 months post-onset, given for 6 months and stopped 16 months post-onset. Corticosteroids were tapered and stopped 15 months post-onset. She had a recurrence of fever at 17 months from onset and was treated with steroids and 2 doses of injected rituximab for a presumed flare of an autoinflammatory manifestation. At 19 months post-onset she developed fever and severe cough with hypoxia requiring ventilation. She was treated for atypical stenotrophomonas maltophila pneumonia with antibiotics, anti-fungals and intravenous immunoglobulin. She remained well for the next year on steroids, azathioprine and hydroxychloroquine. At 31 months post-onset she developed recurrence of fever and cough. A CT scan of the chest showed right 7th rib osteomyelitis near the previous surgical wound (Figure 1C). A rib excision was carried out that again showed dematiaceous fungi (Cladophialophora spp, Figure 1D) and she was treated with itraconazole for 1.5 months. A summary of her clinical course is shown in Figure 1E.

Given her unusual presentation with multiple episodes of severe infection and inflammation, she underwent whole exome sequencing. This demonstrated a homozygous mutation in the CYBC1 gene (rs1291759701), Exon 7, c.327dup (p.Val110CysfsTer40), predicted to be pathogenic and a provisional diagnosis of diagnosis of CGD was established. This was confirmed by Sanger sequencing (Figure 2A). There were no deleterious mutations in known NADPH oxidase subunits. This mutation results in the insertion of a nucleotide that has two linked consequences:

Figure 2:
  • Download figure
  • Open in new tab
Figure 2: Novel EROS mutation abrogates EROS and cannot support gp91phox expression

(A) Sanger sequencing of CYBC1 in patient carrying the c.327dup (p.Val110CysfsTer40) mutation. (B) Normal and c.327dup (p.Val110CysfsTer40) EROS DNA was transfected into HEK293 cells and EROS protein expression measured by western blot and (C) gene expression measured by qPCR. EROS probes targeting several exon junctions were used. EROS is shown relative to HRPT. (D) GFP-tagged c.327dup (p.Val110CysfsTer40) and normal EROS DNA were transfected into HEK293 cells and analysed by flow cytometry. (E) Normal or c.327dup (p.Val110CysfsTer40) EROS was co-transfected with gp91phox into HEK293 cells and analysed by western blot. (F) Normal or GFP-tagged c.327dup (p.Val110CysfsTer40) EROS DNA were cloned into a lentiviral backbone, transfected into HEK293T cells and transfection efficiency evaluated by flow cytometry. (G) The resulting lentivirus was used to transduce normal or GFP-tagged c.327dup (p.Val110CysfsTer40) EROS DNA into PLB985 EROS-/- cells, GFP expression was measured by flow cytometry and (H) expression of gp91phox and EROS was determined by western blot. Data are representative of n=3 experiments. N.S = non-specific band.

  1. A frameshift from amino acid 110

  2. A premature stop codon at amino acid 140

Gnomad curates this variant as a putative loss-of-function variant 6. There are no homozygotes for this allele (or for any other EROS/CYBC1 loss of function allele) in Gnomad, although heterozygotes are reported at a minor allele frequency of 0.00006545 in South Asian populations. The variant was not noted in any other ethnic group 6.

We performed experiments to examine whether this mutation was pathogenic. First, we used site directed mutagenesis to recapitulate the c.327dup (p.Val110CysfsTer40) mutation found in the patient in a pcDNA3.1 vector that expresses untagged EROS. We transfected the control and mutant vectors into HEK293 cells. In line with our previous studies, transfection with the control vector led to high levels of EROS expression 4. However, expression of the mutant vector did not lead to expression of any detectable EROS protein in multiple experiments and in a variety of transfection conditions (Figure 2B). The lack of expression of EROS protein by the mutant allele was not due to a failure of RNA expression or differing transfection efficiency; RNA expression of EROS at multiple exon junctions was equivalent following transfection of both control and mutant alleles (Figure 2C). We also saw no expression of the mutant allele compared with the wild-type allele when transfected into NIH3T3 cells, which express no endogenous EROS protein (supplementary figure 1A). We reasoned that some mutant frameshifted EROS protein might still be made from the mutant allele but that it is no longer recognised by the anti-EROS antibody, which is specific for the C-terminus of the protein. To address this, we also engineered the mutant into a vector in which human EROS is fused with GFP at its C-terminus by site directed mutagenesis. Using GFP as a proxy for EROS expression we observed strong expression of the control vector but negligible expression of the mutant (Figure 2D). Similar results were also seen when we electroporated control and mutant GFP vectors into EROS deficient clone 14 cells (supplementary figure 1B).

Supplemental Figure 1:
  • Download figure
  • Open in new tab
Supplemental Figure 1:

(A) Normal and c.327dup (p.Val110CysfsTer40) EROS DNA was transfected into NIH3T3 cells and EROS and gp91phox protein expression was measured by western blot (B) GFP-tagged c.327dup (p.Val110CysfsTer40) and normal EROS DNA were nucleofected into PLB985 EROS-/- cells. (C) Transduction of normal EROS successfully reconstituted gp91phox expression in PLB985 EROS-/- cells. Actin or vinculin used as loading control. Data are representative of n=3 experiments.

Our previous work demonstrates the importance of EROS on gp91phox stability 4. Co-transfection of gp91phox with EROS leads to much greater expression of gp91phox than transfection of the gp91phox construct alone. Expression of the immature 58kDa gp91phox precursor was markedly increased by wild type EROS but not by the mutant vector (Figure 2E).

A further way to assess whether a mutation in EROS leads to a functional effect is to use an EROS-GFP expressing lentivirus to reconstitute EROS expression in our previously described EROS-deficient PLB985 cell line, and determine whether this restores gp91phox expression (supplementary figure 1B). We created the c.327dup (p.Val110CysfsTer40) mutation in our lentiviral vector. As expected, this also led to negligible EROS protein expression and no reconstitution of gp91phox expression (Figure 2F-H).

Discussion

CGD is a life threatening inborn error of immunity associated with severe morbidity and premature mortality. Early diagnosis is important as the prognosis is improved by factors such as appropriate prophylactic therapy, prompt treatment of severe fungal infections, recognition of inflammatory complications and management at specialist centres. Similarly, recent experience with haematopoietic stem cell therapy suggests that outcomes are excellent if patients are transplanted before they accrue severe complications in CGD, though more data are still required 7,8. Until recently, much of our knowledge of CGD was based on experience in high income countries such as the USA9, Western Europe10 and Japan11. Recently, there have been descriptions of cohorts in lower/middle income countries and these highlight distinct features of CGD such as the predominance of autosomal recessive CGD over X-linked CGD 12,13.

Mutations in EROS/CYBC1 remain scarce and it is difficult to determine at present to what extent this form of IEI resembles classical CGD caused by mutations in gp91phox, p22phox, p47phox and p67phox. Notably, p40phox deficiency is a distinct clinical entity from those described above 14,15. Two major factors suggest that EROS/CYBC1 deficiency may have distinct features:

  1. EROS deficiency removes most but not all gp91phox-p22phox

  2. EROS controls the expression of other proteins such as P2×7 2,4,16.

The patient we describe has a clinical history compatible with CGD including repeated episodes of granulomatous inflammation, severe and repeated infection with both bacterial and fungal pathogens and autoinflammatory phenomena. Septicaemia from Salmonella species is well recognised in CGD 10,17,18. Severe susceptibility to Salmonella Typhimurum infection in an in vivo screen was the means by which EROS was discovered 2. Osteomyelitis due to Cladophialophora has also been described in CGD 19. Mycobacterial infections are well recognised in CGD, particularly in areas of the world where they are endemic 20.

CGD is increasingly recognised in India. A previous report from a large centre in India showed that while they had described 17 cases before 2013, they described a further 21 between 2013 and 2017 21. A recent multi-centre study of 236 patients in India expanded the phenotype further 22. This cohort focused largely on patients with mutations in CYBB (gp91phox) and NCF1 (p47phox). In many respects, the patient that we describe here had a typical course for “classic” CGD both in terms of the localisation of infection and the organisms identified. For instance, she had pneumonia and lung inflammation, lymphadenitis, liver abscess and septicaemia. These are all well recognised features of CGD in general and also in the recent Indian cohort study. Similarly, the organisms identified in this patient are also well recognised CGD pathogens.

Our study is limited by the lack of availability of patient cells to confirm the absence of EROS, gp91phox and p22phox protein expression secondary to the mutation. This was caused by the logistical difficulties of transporting blood from the remote area in which the patient lived. Nevertheless, we were able to confirm the mutation by Sanger sequencing and demonstrate that it led to no detectable protein expression in several cell lines. These data, together with the typical clinical course, make it overwhelmingly likely that this is the third described mutation in EROS/CYBC1 deficiency (CGD5).

Individuals that are heterozygous for the mutation we describe here have been observed in databases such as Gnomad, thus far restricted to people of South Asian ancestry. As such, we predict that there will be more cases of CGD5 caused by this mutation in EROS/CYBC1, both in India and elsewhere. The diagnosis should be considered in cases of CGD or other inborn errors of immunity, particularly when the generation of ROS is impaired without mutations in CYBB, CYBA, NCF1, NCF2 and NCF4.

Methods

Consent

Informed consent for this study was obtained from the patient and family and ethical approval was granted by the Institutional Ethics Committee of Aster CMI Hospital, Bengaluru. IEC Regd. No. ECR/1084/Inst/KA/2018. The patient and their family are happy for the case to be published.

Cell line culture

HEK293 and HEK293T cells were grown in complete DMEM (DMEM (Gibco) + 10% FBS (Pan biotech) + 1% penicillin-streptomycin-glutamine (ThermoFisher) + 1% sodium pyruvate (ThermoFisher). PLB985 and EROS-/- PLB985 cell lines were grown in complete RPMI (RPMI 1640 (Gibco), + 10% FBS + 1% penicillin-streptomycin-glutamine + 1% sodium pyruvate + 1% HEPES (ThermoFisher) +1% GlutaMAX (ThermoFisher)).

DNA plasmids

DNA plasmids were obtained from Origene; untagged human EROS (SC324452), GFP tagged human EROS (RG200883) untagged gp91phox (SC122091), lentiEROS GFP tagged (RC200883L4) and equivalent empty vector (PS100093).

Sanger sequencing

Patient and healthy donor DNA was isolated from whole blood using the Gentra PureGene kit (Qiagen), according to manufacturers’ instructions. DNA was subjected to standard PCR with the primers listed below. Amplified DNA was sequenced by GeneWiz and aligned using SnapGene.

Forward: AGTGCAGTGTAAAGATGG

Reverse: GTCCACAAACTCATCTCC

Site-directed mutagenesis

A vector encoding EROS was generated using site-directed mutagenesis with primers listed below. Transfection was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) as per the manufacturer’s instructions.

Forward (F327T): TGCTCCATGATGTCCGTGATTGTGAGCGTGGA

Reverse (R327A): TCCACGCTCACAATCACGGACATCATGGAGCA

Transfection

HEK293/T cells were transfected with 1.2-1.8ng of DNA using lipofectamine RNAiMAX (Invitrogen) or lipofectamine2000 (Invitrogen). Cells were harvested at 48 or 72hrs for RNA, protein extraction and flow cytometry analysis.

Nucleofection

EROS-/- PLB985 cells were nucleofected using the SF cell line 4D-Nucleofector X Kit L (Lonza), following manufacturer’s instructions. 1.2ng EROS-GFP or mutant EROS-GFP DNA was pulsed into cells using the EN-138 programme. Cells were harvested after 48hrs for flow cytometry analysis.

Western blot

1×106 cells were lysed with Pierce RIPA lysis buffer (ThermoFisher) containing 1x protein phosphatase inhibitor (ThermoFisher) and incubated for 30 minutes on ice. Debris was pelleted by centrifugation at 14000xg for 30 minutes at 4°C. Protein concentration was determined by BCA assay (ThermoFisher) according to manufacturer’s instructions. 20μg of protein was mixed with 4x LDS sample buffer (ThermoFisher) + 10% reducing agent (Invitrogen) and denatured at 72°C for 10 minutes. Samples were run on NuPAGE 4-12% Bis-Tris gels (ThermoFisher) in 1x MOPS running buffer (Formedium) at 100-150v for 60-90mins. Proteins were transferred to a nitrocellulose membrane (ThermoFisher) in transfer buffer (3.05g Tris base (Sigma) + 14.45g Glycine (Sigma) + 800ml dH2O + 200ml methanol) and ran for 1 hour 15 mins at 100v. The membrane was blocked in 5% skim milk (Marvel) in TBST for 1 hour at room temperature. Membrane was cut and probed with appropriate primary antibody; actin (1:2500, abcam), EROS (1:1000, Atlas), gp91phox (1:1000, Santa Cruz), vinculin (1:1000, CST) in blocking buffer overnight at 4°C on a roller. Membranes were washed 3x in TBST for 10 minutes and incubated with appropriate secondary antibody (anti-rabbit IgG horseradish peroxidase, 1:10000 (CST) or anti-mouse IgG horseradish peroxidase, 1:10000 (CST)) in blocking buffer for 1 hour at room temperature. The blots were developed with SuperSignal West Pico PLUS (ThermoFisher) or SuperSignal West Femto PLUS (ThermoFisher) according to manufacturer’s instructions and imaged on a ChemiDoc (BioRad).

qPCR

1×106 cells were resuspended in RLT buffer (QIAGEN) + 10% β-mercaptoethanol (Sigma) on ice. RNA was extracted using QIAGEN RNAeasy mini kit according to manufacturer’s instructions. cDNA synthesis was carried out using superscript IV VILO master mix (Invitrogen) according to manufacturer’s instructions using 1μg of RNA. qPCR performed using TaqMan Fast advanced master mix (ThermoFisher) according to manufacturer’s instructions. EROS primers used were Hs00978805 exon 2-3, Hs00978806 exon 3-4, Hs00978808 exon 5-6 and housekeeping HPRT Hs02800695 (ThermoFisher).

Flow cytometry

GFP tagged samples were acquired on a LSRFortessa (BD).

Generation of lentivirus

Lentiviral mix was added to HEK293T cells at a ratio of 4 lentiviral plasmid: 3 psPAX2 (Addgene): 1 pMD2.G (Addgene), using 7μg of lentiviral plasmid in lipofectamine2000. Cells were incubated at 37°C, 5% CO2 for 48hrs. The viral supernatant was harvested and filtered and concentrated using LentiX concentrator (Takara). Transfected HEK293T cells were harvested and analysed by flow cytometry to assess transfection efficiency.

Lentiviral transduction

1×105 PLB985 and EROS-/- PLB985 cells were transduced with viral supernatant plus 8μg/ml polybrene (Merck) and incubated at 37°C, 5% CO2 for 72 hrs. Transduction efficiency was analysed by flow cytometry to determine GFP expression. Remaining cells were expanded in culture and harvested for western blot.

Figures were created using Biorender.

Data Availability

All data produced in the present work are contained in the manuscript

Funding Statement

This work was supported by funding from a Wellcome-Beit Prize Trust Clinical Research Career Development Fellowship (20661206617/A/17/Z and 206617/A/17/A) and the Sidharth Burman endowment. MCP is a Wellcome Trust Senior Fellow in Clinical Science (212252/Z/18/Z) and THM is supported by this fellowship.

We acknowledge support from the National Institute for Health Research (NIHR) Biomedical Research Centre based at Imperial College Healthcare National Health Service Trust and Imperial College London, and from the NIHR Clinical Research Network. The views expressed are those of the authors and not necessarily those of the National Health Service, the NIH, or the Department of Health.

We thank the LMS/NIHR Imperial Biomedical Research Centre Flow Cytometry Facility for their support.

Declarations

None of the authors has any potential financial conflict of interest related to this manuscript. Declarations of interest: none - manuscript file

Acknowledgements

We thank the patient and family for their contributions to this research. We thank Dr Kerry Rostron for facilitating several logistic aspects of this study.

Footnotes

  • ↵* joint first authorship

  • ↵$ joint senior authorship

Abbreviations

ATT
Anti-Tuberculosis Treatment
CGD
Chronic Granulomatous Disease
DHR
Dihydrorhodamine
EROS
Essential for Reactive Oxygen Species
IEI
Inherited Error of Immunity
NADPH
Nicotinamide adenine dinucleotide phosphate
ROS
Reactive Oxygen Species

References

  1. ↵
    Mortimer PM, Mc Intyre SA, Thomas DC. Beyond the Extra Respiration of Phagocytosis: NADPH Oxidase 2 in Adaptive Immunity and Inflammation. Front Immunol 2021; 12. DOI:10.3389/fimmu.2021.733918.
    OpenUrlCrossRef
  2. ↵
    Thomas DC, Clare S, Sowerby JM, et al. Eros is a novel transmembrane protein that controls the phagocyte respiratory burst and is essential for innate immunity. Journal of Experimental Medicine 2017; 214: 1111–28.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Thomas DC, Charbonnier L-M, Schejtman A, et al. EROS/CYBC1 mutations: Decreased NADPH oxidase function and chronic granulomatous disease. Journal of Allergy and Clinical Immunology 2019; 143: 782–785.e1.
    OpenUrl
  4. ↵
    Randzavola LO, Mortimer PM, Garside E, et al. EROS-mediated control of NOX2 and P2×7 biosynthesis. 2021. DOI:10.1101/2021.09.14.460103.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Arnadottir GA, Norddahl GL, Gudmundsdottir S, et al. A homozygous loss-of-function mutation leading to CYBC1 deficiency causes chronic granulomatous disease. Nat Commun 2018; 9. DOI:10.1038/s41467-018-06964-x.
    OpenUrlCrossRef
  6. ↵
    Karczewski KJ, Francioli LC, Tiao G, et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 2020 581:7809 2020; 581: 434–43.
    OpenUrlCrossRefPubMed
  7. ↵
    Chiesa R, Wang J, Blok HJ, et al. Hematopoietic cell transplantation in chronic granulomatous disease: a study of 712 children and adults. Blood 2020; 136: 1201–11.
    OpenUrl
  8. ↵
    Morris EC. HCT for CGD? Yes, and the sooner the better. Blood 2020; 136: 1121–3.
    OpenUrl
  9. ↵
    Leiding JW, Holland SM. Chronic Granulomatous Disease. GeneReviews® 2022; published online April 21. https://www.ncbi.nlm.nih.gov/books/NBK99496/ x(accessed Nov 11, 2022).
  10. ↵
    van den Berg JM, van Koppen E, Åhlin A, et al. Chronic Granulomatous Disease: The European Experience. PLoS One 2009; 4. DOI:10.1371/JOURNAL.PONE.0005234.
    OpenUrlCrossRef
  11. ↵
    Yanagimachi M, Kato K, Iguchi A, et al. Hematopoietic Cell Transplantation for Chronic Granulomatous Disease in Japan. Front Immunol 2020; 11: 1617.
    OpenUrl
  12. ↵
    Mortaz E, Azempour E, Mansouri D, et al. Common Infections and Target Organs Associated with Chronic Granulomatous Disease in Iran. Int Arch Allergy Immunol 2019; 179: 62–73.
    OpenUrl
  13. ↵
    Bakri FG, Mollin M, Beaumel S, et al. Second Report of Chronic Granulomatous Disease in Jordan: Clinical and Genetic Description of 31 Patients From 21 Different Families, Including Families From Lybia and Iraq. Front Immunol 2021; 12: 639226.
    OpenUrl
  14. ↵
    Matute JD, Arias AA, Wright NAM, et al. A new genetic subgroup of chronic granulomatous disease with autosomal recessive mutations in p40phox and selective defects in neutrophil NADPH oxidase activity. Blood 2009; 114: 3309.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    van de Geer A, Nieto-Patlán A, Kuhns DB, et al. Inherited p40phox deficiency differs from classic chronic granulomatous disease. J Clin Invest 2018; 128: 3957.
    OpenUrl
  16. ↵
    Ryoden Y, Fujii T, Segawa K, Nagata S. Functional Expression of the P2×7 ATP Receptor Requires Eros. The Journal of Immunology 2020; 204: 559–68.
    OpenUrl
  17. ↵
    Lin TS, Lee JH, Wang LC, et al. Clinical features and outcomes of patients with chronic granulomatous disease in Taiwan. Journal of Microbiology, Immunology and Infection 2022; published online July 6. DOI:10.1016/J.JMII.2022.06.005.
    OpenUrlCrossRef
  18. ↵
    Roos D, de Boer M. Molecular diagnosis of chronic granulomatous disease. Clin Exp Immunol 2014; 175: 139.
    OpenUrlCrossRefPubMed
  19. ↵
    Shigemura T, Agematsu K, Yamazaki T, et al. Femoral osteomyelitis due to Cladophialophora arxii in a patient with chronic granulomatous disease. Infection 2009 37:5 2009; 37: 469–73.
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    Conti F, Lugo-Reyes SO, Blancas Galicia L, et al. Mycobacterial disease in patients with chronic granulomatous disease: A retrospective analysis of 71 cases. Journal of Allergy and Clinical Immunology 2016; 138: 241–248.e3.
    OpenUrlCrossRef
  21. ↵
    Rawat A, Vignesh P, Sharma A, et al. Infection Profile in Chronic Granulomatous Disease: a 23-Year Experience from a Tertiary Care Center in North India. J Clin Immunol 2017; 37: 319–28.
    OpenUrl
  22. ↵
    Rawat A, Vignesh P, Sudhakar M, et al. Clinical, Immunological, and Molecular Profile of Chronic Granulomatous Disease: A Multi-Centric Study of 236 Patients From India. Front Immunol 2021; 12. DOI:10.3389/fimmu.2021.625320.
    OpenUrlCrossRef
Back to top
PreviousNext
Posted April 25, 2023.
Download PDF
Data/Code
Email

Thank you for your interest in spreading the word about medRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Enter multiple addresses on separate lines or separate them with commas.
A novel mutation in EROS (CYBC1) causes Chronic Granulomatous Disease
(Your Name) has forwarded a page to you from medRxiv
(Your Name) thought you would like to see this page from the medRxiv website.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
A novel mutation in EROS (CYBC1) causes Chronic Granulomatous Disease
Paige M Mortimer, Esme Nichols, Joe Thomas, Rachna Shanbhag, Neha Singh, Eve L Coomber, Talat H Malik, Matthew C Pickering, Lyra Randzavola, William Rae, Sagar Bhattad, David C Thomas
medRxiv 2023.04.21.23286144; doi: https://doi.org/10.1101/2023.04.21.23286144
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools
A novel mutation in EROS (CYBC1) causes Chronic Granulomatous Disease
Paige M Mortimer, Esme Nichols, Joe Thomas, Rachna Shanbhag, Neha Singh, Eve L Coomber, Talat H Malik, Matthew C Pickering, Lyra Randzavola, William Rae, Sagar Bhattad, David C Thomas
medRxiv 2023.04.21.23286144; doi: https://doi.org/10.1101/2023.04.21.23286144

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Subject Area

  • Allergy and Immunology
Subject Areas
All Articles
  • Addiction Medicine (349)
  • Allergy and Immunology (668)
  • Allergy and Immunology (668)
  • Anesthesia (181)
  • Cardiovascular Medicine (2648)
  • Dentistry and Oral Medicine (316)
  • Dermatology (223)
  • Emergency Medicine (399)
  • Endocrinology (including Diabetes Mellitus and Metabolic Disease) (942)
  • Epidemiology (12228)
  • Forensic Medicine (10)
  • Gastroenterology (759)
  • Genetic and Genomic Medicine (4103)
  • Geriatric Medicine (387)
  • Health Economics (680)
  • Health Informatics (2657)
  • Health Policy (1005)
  • Health Systems and Quality Improvement (985)
  • Hematology (363)
  • HIV/AIDS (851)
  • Infectious Diseases (except HIV/AIDS) (13695)
  • Intensive Care and Critical Care Medicine (797)
  • Medical Education (399)
  • Medical Ethics (109)
  • Nephrology (436)
  • Neurology (3882)
  • Nursing (209)
  • Nutrition (577)
  • Obstetrics and Gynecology (739)
  • Occupational and Environmental Health (695)
  • Oncology (2030)
  • Ophthalmology (585)
  • Orthopedics (240)
  • Otolaryngology (306)
  • Pain Medicine (250)
  • Palliative Medicine (75)
  • Pathology (473)
  • Pediatrics (1115)
  • Pharmacology and Therapeutics (466)
  • Primary Care Research (452)
  • Psychiatry and Clinical Psychology (3432)
  • Public and Global Health (6527)
  • Radiology and Imaging (1403)
  • Rehabilitation Medicine and Physical Therapy (814)
  • Respiratory Medicine (871)
  • Rheumatology (409)
  • Sexual and Reproductive Health (410)
  • Sports Medicine (342)
  • Surgery (448)
  • Toxicology (53)
  • Transplantation (185)
  • Urology (165)